939 resultados para Ductile-fragile transition
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.
Resumo:
A two-step method of loading controlled amounts of transition metal cations into alumina pillared clays (Al-PILCs) is proposed. First, calcined Al-PILC was dispersed into an aqueous solution of sodium or ammonium ions. Increasing the pH of the dispersion resulted in an increase in the amount of cations loaded into the clay. The ion-doped Al-PILC was then exchanged with an aqueous solution of transition metal salt at a pH of similar to 4.5 to replace Na+ or NH4+ ions by transition metal cations. Analytical techniques such as atomic absorption spectroscopy, X-ray diffraction, diffuse reflectance-ultraviolet-visible spectroscopy, as well as N-2 adsorption were used to characterize the PILC products with and without the loading of metal ions. The introduced transition metal species exist in the forms of hydrated ions in the PILC hosts. The content of transition metal ions in the final product increased with the amount of Na+ or NH4+ loaded in the first step so that by controlling the pH of the dispersion in the first step, one can control the doping amounts of transition metal cations into Al-PILCs. A sample containing 0.125 mmol/g of nickel was thus obtained, which is similar to 3 times of that obtained by directly exchanging Al-PILC with Ni(NO3)(2) solution, while the pillared layered structures of the Al-PILC remained. The porosity analysis using N-2 adsorption data indicated that most of the doped transition metal ions dispersed homogeneously in the micropores of the Al-PILC, significantly affecting the micropore structure.
Resumo:
Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.
Resumo:
Sensory axons of different sensory modalities project into typical domains within insect ganglia. Tactile and gustatory axons project into a ventral layer of neuropil and proprioceptive afferents, including chordotonal axone, into an intermediate or dorsal layer. Here, we describe the central projections of sensory neurons in the first instar Drosophila larva, relating them to the projection of the same sensory afferents in the embryo and to sensory afferents of similar type in other insects. Several neurons show marked morphologic changes in their axon terminals in the transition between the embryo and larva. During a short morphogenetic period late in embryogenesis, the axon terminals of the dorsal bipolar dendrite stretch receptor change their shape and their distribution within the neuromere. In the larva, external sense organ neurons (es) project their axons into a ventral layer of neuropil. Chordotonal sensory neurons (ch) project into a slightly more dorsal region that is comparable to their projection in adults. The multiple dendrite (md) neurons show two distinctive classes of projection. One group of md neurons projects into the ventral-most neuropil region, the same region into which es neurons project. Members of this group are related by lineage to es neurons or share a requirement for expression of the same proneural gene during development. Other md neurons project into a more dorsal region. Sensory receptors projecting into dorsal neuropil possibly provide proprioceptive feedback from the periphery to central motorneurons and are candidates for future genetic and cellular analysis of simple neural circuitry. J. Comp. Neurol. 425:34-44, 2000. (C) 2000 Wiley-Liss, Inc.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Teen Triple P is a multilevel system of intervention that is designed to provide parents with specific strategies to promote the positive development of their teenage children as they make the transition into high school and through puberty. The program is based on a combination of education about the developmental needs of adolescents, skills training to improve communication and problem-solving, plus specific modules to deal with common problems encountered by parents and adolescents that can escalate into major conflict and violence. It is designed to increase the engagement of parents of adolescent and pre-adolescent children by providing them with easy access to evidencebased parenting advice and support. This paper presents data collected as part of a survey of over 1400 students in first year high school at 9 Brisbane schools. The survey instrument was constructed to obtain students' reports about behaviour which is known to be associated with their health and wellbeing, and also on the extent to which their parents promoted or discouraged such behaviour at home, at school, and in their social and recreational activities in the wider community. Selected data from the survey were extracted and presented to parents at a series of parenting seminars held at the schools to promote appropriate parenting of teenagers. The objectives were to provide parents with accurate data about teenagers' behaviour, and about teenagers' reports of how they perceived their parents' behaviour. Normative data on parent and teenager behaviour will be presented from the survey as well as psychometric data relating to the reliability and validity of this new measure. Implications of this strategy for increasing parent engagement in parenting programs that aim to reduce behavioural and emotional problems in adolescents will be discussed.
Resumo:
A Cellular-Automaton Finite-Volume-Method (CAFVM) algorithm has been developed, coupling with macroscopic model for heat transfer calculation and microscopic models for nucleation and growth. The solution equations have been solved to determine the time-dependent constitutional undercooling and interface retardation during solidification. The constitutional undercooling is then coupled into the CAFVM algorithm to investigate both the effects of thermal and constitutional undercooling on columnar growth and crystal selection in the columnar zone, and formation of equiaxed crystals in the bulk liquid. The model cannot only simulate microstructures of alloys but also investigates nucleation mechanisms and growth kinetics of alloys solidified with various solute concentrations and solidification morphologies.
Resumo:
Using the exact Bethe ansatz solution of the Hubbard model and Luttinger liquid theory, we investigate the density profiles and collective modes of one-dimensional ultracold fermions confined in an optical lattice with a harmonic trapping potential. We determine a generic phase diagram in terms of a characteristic filling factor and a dimensionless coupling constant. The collective oscillations of the atomic mass density, a technique that is commonly used in experiments, provide a signature of the quantum phase transition from the metallic phase to the Mott-insulator phase. A detailed experimental implementation is proposed.
Resumo:
We consider a kinetic Ising model which represents a generic agent-based model for various types of socio-economic systems. We study the case of a finite (and not necessarily large) number of agents N as well as the asymptotic case when the number of agents tends to infinity. The main ingredient are individual decision thresholds which are either fixed over time (corresponding to quenched disorder in the Ising model, leading to nonlinear deterministic dynamics which are generically non-ergodic) or which may change randomly over time (corresponding to annealed disorder, leading to ergodic dynamics). We address the question how increasing the strength of annealed disorder relative to quenched disorder drives the system from non-ergodic behavior to ergodicity. Mathematically rigorous analysis provides an explicit and detailed picture for arbitrary realizations of the quenched initial thresholds, revealing an intriguing ""jumpy"" transition from non-ergodicity with many absorbing sets to ergodicity. For large N we find a critical strength of annealed randomness, above which the system becomes asymptotically ergodic. Our theoretical results suggests how to drive a system from an undesired socio-economic equilibrium (e. g. high level of corruption) to a desirable one (low level of corruption).
Resumo:
The pocilloporin Rtms5 and an engineered variant Rtms5(H146S) undergo distinct color transitions (from blue to red to yellow to colorless) in a pH-dependent manner. pK(a) values of 4.1 and 3.2 were determined for the blue (absorption lambda(max), 590 nm) to yellow (absorption lambda(max), similar to 453 nm) transitions of Rtms5 and Rtms5H(146). The pK(a) for the blue-yellow transition of Rtms5H(146S) increased by 1.4 U in the presence of 0.1 M KI, whereas the pK(a) for the same transition of Rtms5 was relatively insensitive to added halides. To understand the structural basis for these observations, we have determined to 2.0 A resolution the crystal structure of a yellow form of Rtms5(H146S) at pH 3.5 in the presence of iodide. Iodide was found occupying a pocket in the structure with a pH of 3.5, forming van der Waals contacts with the tyrosyl moiety of the chromophore. Elsewhere, it was determined that this pocket is occupied by a water molecule in the Rtms5(H141S) structure (pH 8.0) and by the side chain of histidine 146 in the wild-type Rtms5 structure. Collectively, our data provide an explanation for the observed linkage between color transitions for Rtms5(H146S) and binding to halides.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Under the conditions of the rotating wave approximation (RWA), a transition strongly driven by a resonant oscillating field displays the well known symmetric Autler-Townes doublet. However, if the counter-rotating component, neglected in the RWA, is taken into account, the Bloch-Siegert shift gives rise to an Autler-Townes doublet of unequal intensity even in the case of a resonant driving field. This effect is investigated theoretically in a V-shaped three-level double-resonance configuration and the results are presented in this paper. An interesting observation is that the level of asymmetry not only depends on the driving-field intensity but also on the characteristics of the driven system including relaxation rates and equilibrium population distributions.
Resumo:
Epithelial to mesenchymal transition (EMT) is a process implicated in cancer progression in which the underlying cellular changes have been identified mainly using in vitro models. We determined the expression of some putative EMT biomarkers including E-cadherin, beta-catenin, zinc finger factor Snail (Snail), transforming growth factor beta 1 (TGF beta 1), TGF beta type II receptor (TBRII) and the HGF receptor (c-met) and their possible correlation to progression and overall survival in a series of breast ductal carcinoma in situ (DCIS) and invasive ductal carcinomas (IDC). Biomarkers were immunohistochemically determined in 55 IDC specimens from which 21 had lymph node metastases and in 95 DCIS specimens, 46 of these cases associated to invasive carcinoma, in a tissue microarray (TMA). Positive cytoplasmic staining of TGF beta 1 (78.2%), c-met (43.6%), Snail (34.5%), TBRII (100%), membranous E-cadherin (74.5%) and membranous/cytoplasmic beta-catenin (71%) were detected in the IDC samples. Metastatic lymph node samples displayed similar frequencies. A significant increase of c-met and TGF beta 1 positivity along DCIS to IDC progression was noted but only TGF beta 1 positivity was associated with presence of lymph node metastases and advanced stages in IDC. The evaluation of the other EMT markers in DCIS did not show differences in positivity rate as compared to invasive carcinomas. DCIS either pure or associated to IDC showed similar expression of the analyzed biomarkers. All the carcinomas exhibited positive expression of TBRII. Associations between the markers, determined by Spearman`s correlation coefficient, showed a significant association between TGF beta 1 and respectively E-cadherin, beta-catenin and cmet in DCIS cases, but in invasive carcinomas only cadherin and catenin were positively correlated. Kaplan-Meier survival curves revealed that none of the EMT biomarkers analyzed were correlated with survival, which was significantly determined only by clinical and hormone receptor parameters.