863 resultados para Direct repeat
Resumo:
Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Conotoxins are valuable probes of receptors and ion channels because of their small size and highly selective activity. alpha-Conotoxin EpI, a 16-residue peptide from the mollusk-hunting Conus episcopatus, has the amino acid sequence GCCSDPRCNMNNPDY(SO3H)C-NH2 and appears to be an extremely potent and selective inhibitor of the alpha 3 beta 2 and alpha 3 beta 4 neuronal subtypes of the nicotinic acetylcholine receptor (nAChR). The desulfated form of EpI ([Tyr(15)]EpI) has a potency and selectivity for the nAChR receptor similar to those of EpI. Here we describe the crystal structure of [Tyr(15)]EpI solved at a resolution of 1.1 Angstrom using SnB. The asymmetric unit has a total of 284 non-hydrogen atoms, making this one of the largest structures solved de novo try direct methods. The [Tyr(15)]EpI structure brings to six the number of alpha-conotoxin structures that have been determined to date. Four of these, [Tyr(15)]EpI, PnIA, PnIB, and MII, have an alpha 4/7 cysteine framework and are selective for the neuronal subtype of the nAChR. The structure of [Tyr(15)]EpI has the same backbone fold as the other alpha 4/7-conotoxin structures, supporting the notion that this conotoxin cysteine framework and spacing give rise to a conserved fold. The surface charge distribution of [Tyr(15)]EpI is similar to that of PnIA and PnIB but is likely to be different from that of MII, suggesting that [Tyr(15)]EpI and MII may have different binding modes for the same receptor subtype.
Resumo:
Recent reports have shown neurodegenerative disorders to be associated with abnormal expansions of a CAG trinucleotide repeat allele at various autosomal loci. While normal chromosomes have 14 to 44 repeats, disease chromosomes may have 60 to 84 repeats. The number of CAG repeats on mutant chromosomes correlates with increasing severity of disease or decreasing age at onset of symptoms. Since we are interested in identifying the many quantitative trait loci (QTL) influencing brain functioning, we examined the possibility that the number of CAG repeats in the normal size range at these loci are relevant to "normal" neural functioning. We have used 150 pairs of adolescent (aged 16 years) twins and their parents to examine allele size at the MJD, SCA1, and DRPLA loci in heterozygous normal individuals. These are part of a large ongoing project using cognitive and physiological measures to investigate the genetie influences on cognition, and an extensive protocol of tests is employed to assess some of the key components of intellectual functioning. This study selected to examine full-scale psychometric IQ (FSIQ) and a measure of information processing (choice reaction time) and working memory (slow wave amplitude). CAG repeat size was determined on an ABI Genescan system following multiplex PCR amplification. Quantitative genetic analyses were performed to determine QTL effects of MJD, SCA1, and DRPLA on cognitive functioning. Analyses are in progress and will be discussed.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
The electrocatalytic activity of Pt and RuO(2) mixed electrodes of different compositions towards methanol oxidation was investigated. The catalysts were prepared by thermal decomposition of polymeric precursors and characterized by energy dispersive X-ray, scanning electronic microscopy, X-ray diffraction and cyclic voltammetry. This preparation method allowed obtaining uniform films with controlled stoichiometry and high surface area. Cyclic voltammetry experiments in the presence of methanol showed that mixed electrodes decreased the potential peak of methanol oxidation by approximately 100 mV (RHE) when compared to the electrode containing only Pt. In addition, voltammetric experiments indicated that the Pt(0.6)Ru(0.4)O(y) electrode led to higher oxidation current densities at lower potentials. Chronoamperometry experiments confirmed the contribution of RuO(2) to the catalytic activity as well as the better performance of the Pt(0.6)Ru(0.4)O(y) electrode composition. Formic acid and CO(2) were identified as being the reaction products formed in the electrolysis performed at 400 and 600 mV. The relative formation of CO(2) was favored in the electrolysis performed at 400 mV (RHE) with the Pt(0.6)Ru(0.4)O(y) electrode. The presence of RuO(2) in Pt-Ru-based electrodes is important for improving the catalytic activity towards methanol electrooxidation. Moreover, the thermal decomposition of polymeric precursors seems to be a promising route for the production of catalysts applicable to DMFC. (C) 2009 International Association for Hydrogen Energy. Published by Elsevier Ltd. All rights reserved.
Resumo:
The image reconstruction using the EIT (Electrical Impedance Tomography) technique is a nonlinear and ill-posed inverse problem which demands a powerful direct or iterative method. A typical approach for solving the problem is to minimize an error functional using an iterative method. In this case, an initial solution close enough to the global minimum is mandatory to ensure the convergence to the correct minimum in an appropriate time interval. The aim of this paper is to present a new, simple and low cost technique (quadrant-searching) to reduce the search space and consequently to obtain an initial solution of the inverse problem of EIT. This technique calculates the error functional for four different contrast distributions placing a large prospective inclusion in the four quadrants of the domain. Comparing the four values of the error functional it is possible to get conclusions about the internal electric contrast. For this purpose, initially we performed tests to assess the accuracy of the BEM (Boundary Element Method) when applied to the direct problem of the EIT and to verify the behavior of error functional surface in the search space. Finally, numerical tests have been performed to verify the new technique.
Resumo:
Direct carotid-cavernous fistula (CCF) is a direct communication between the internal carotid artery (ICA) and the cavernous sinus. Some patients treated with detachable balloons develop pseudoaneurysms or present with a true aneurysm recanalization in the cavernous ICA with poorly known long-term radiological and clinical progression. The objective of the present study was to evaluate the long-term clinical and radiological progression of patients treated with detachable balloons. The present study evaluated 13 patients previously treated for direct CCF by an endovascular approach. The follow-up period ranged between 19 and 128 months. Ophthalmological evaluation demonstrated alterations in eight patients (61.5%). All of these alterations were already present from the moment of the treatment and displayed no signs of progression. Cranial magnetic resonance imaging (MRI) and magnetic resonance angiography (MRA) were performed in all patients, and 11 pseudoaneurysms were demonstrated in ten of the 11 patients in whom ICA patency had been preserved. Five patients were submitted for cerebral digital subtraction angiography (DSA) to characterize the pseudoaneurysms previously observed on MRA studies, with no significant differences in morphology, size, aneurismal neck, and number of lesions. Endovascular treatment of direct CCF with detachable balloons has been shown to be a long-term effective and stable therapeutic method. The authors found asymptomatic pseudoaneurysms in 91% of cases where the ICA patency was preserved. MRI and MRA demonstrated an accuracy similar to that of DSA in the diagnosis of pseudoaneurysms of cavernous ICA.
Resumo:
To date very Few families of critical sets for latin squares are known. The only previously known method for constructing critical sets involves taking a critical set which is known to satisfy certain strong initial conditions and using a doubling construction. This construction can be applied to the known critical sets in back circulant latin squares of even order. However, the doubling construction cannot be applied to critical sets in back circulant latin squares of odd order. In this paper a family of critical sets is identified for latin squares which are the product of the latin square of order 2 with a back circulant latin square of odd order. The proof that each element of the critical set is an essential part of the reconstruction process relies on the proof of the existence of a large number of latin interchanges.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Objective. Circumstantial evidence links retroviruses (RVs) with human autoimmune diseases, The aim of the present study was to obtain direct evidence of RV gene expression in rheumatoid arthritis (RA). Methods. Synovial samples were obtained from patients with RA, patients with osteoarthritis (OA), and normal control subjects, Reverse transcription-polymerase chain reaction (RT-PCR) was performed using synovial RNA and primers to conserved sequences in the polymerase (pol) genes of known RVs. Results. PCR products (n = 857) were cloned and sequenced, Multiple pol transcripts, many with open reading frames, were expressed in every sample, Sequences were aligned and classified into 6 families (F1-F6) that contained 33 groups of known and unknown endogenous RVs (ERVs), each distinguished by a specific, deduced peptide motif, The frequency of sequences in each family was similar between RA, OA, and normal synovial tissue, but differed significantly in RA synovial fluid cells, F1 sequences (undefined, but related to murine and primate type C RVs) were lower in frequency, F2 (ERV-9-related), F4 (HERV-K-related), and F6 (HERV-L-related) sequences were higher in frequency, and F3 (RTVL-H-related) sequences were not detected, in the RA synovial fluid cells compared with the RA synovial tissues. Conclusion. Multiple ERVs are expressed in normal and diseased synovial compartments, but specific transcripts can be differentially expressed in RA.