167 resultados para DNase


Relevância:

10.00% 10.00%

Publicador:

Resumo:

I have cloned cDNAs corresponding to two distinct genes, Xlmf1 and Xlmf25, which encode skeletal muscle-specific, transcriptional regulatory proteins. These proteins are members of the helix-loop-helix family of DNA binding factors, and are most homologous to MyoD1. These two genes have disparate temporal expression patterns during early embryogenesis; although, both transcripts are present exclusively in skeletal muscle of the adult. Xlmf1 is first detected 7 hours after fertilization, shortly after the midblastula transition. Xlmf25 is detected in maternal stores of mRNA, during early cleavage stages of the embryo and throughout later development. Both Xlmf1 and Xlmf25 transcripts are detected prior to the expression of other, previously characterized, muscle-specific genes. The ability of Xlmf1 and Xlmf25 to convert mouse 10T1/2 fibroblasts to a myogenic phenotype demonstrates their activity as myogenic regulatory factors. Additionally, Xlmf1 and Xlmf25 can directly transactivate a reporter gene linked to the muscle-specific, muscle creatine kinase (MCK) enhancer. The functional properties of Xlmf1 and Xlmf25 proteins were further explored by investigating their interactions with the binding site in the MCK enhancer. Analysis of dissociation rates revealed that Xlmf25-E12 dimers had a two-fold lower avidity for this site than did Xlmf1-E12 dimers. Clones containing genomic sequence of Xlmf1 and Xlmf25 have been isolated. Reporter gene constructs containing a lac-z gene driven by Xlmf1 regulatory sequences were analyzed by embryo injections and transfections into cultured muscle cells. Elements within $-$200 bp of the transcription start site can promote high levels of muscle specific expression. Embryo injections show that 3500 bp of upstream sequence is sufficient to drive somite specific expression. EMSAs and DNAse I footprint analysis has shown the discrete interaction of factors with several cis-elements within 200 bp of the transcription start site. Mutation of several of these elements shows a positive requirement for two CCAAT boxes and two E boxes. It is evident from the work performed with this promoter that Xlmf1 is tightly regulated during muscle cell differentiation. This is not surprising given the fact that its gene product is crucial to the determination of cell fate choices. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A fundamental problem in developmental biology concerns the mechanisms involved in the establishment of the embryonic axis. We are studying Xenopus nuclear factor 7 (xnf7) which we believe to be involved in dorsal-ventral patterning in Xenopus laevis. Xnf7 is a maternal gene product that is retained in the cytoplasm during early embryogenesis until the mid-blastula transition (MBT) when it reenters the nuclei. It is a member of a novel zinc finger proteins, the B-box family, consisting mainly of transcription factors and protooncogenes.^ The xnf7 gene is reexpressed during embryogenesis at the gastrula-neurula stage of development, with its zygotic expression limited to the central nervous system (CNS). In this study we showed that there are two different cDNAs coding for xnf7, xnf7-O and xnf7-B. They differ by 39 amino acid changes scattered throughout the cDNA. The expression of both forms of xnf7 is limited primarily to the central nervous system (CNS) and dorsal axial structures during later stages of embryogenesis.^ In order to study the spatial and temporal regulation of the gene, we screened a Xenopus genomic library using part of xnf7 cDNA as a probe. A genomic clone corresponding to the xnf7-O type was isolated, its 5$\sp\prime$ putative regulatory region sequenced, and its transcriptional initiation site mapped. The putative promoter region contained binding sites for Sp1, E2F, USF, a Pu box and AP1. CAT/xnf7 fusion genes were constructed containing various 5$\sp\prime$ deleted regions of the xnf7 promoter linked to a CAT (Chloramphenicol Acetyl Transferase) reporter vector. These constructs were injected into Xenopus oocytes and embryos to study the regions of the xnf7 promoter responsible for basal, temporal and spatial regulation of the gene. The activity of the fusion genes was measured by the conversion of chloramphenicol to its acetylated forms, and the spatial distribution of the transcripts by whole mount in situ hybridization. We showed that the elements involved in basal regulation of xnf7 lie within 121 basepairs upstream of the transcriptional inititiation site. A DNase I footprint analysis performed using oocyte extract showed that a E2F and 2 Sp1 sites were protected. During development, the fusion genes were expressed following the MBT, in accordance with the timing of the endogenous xnf7 gene. Spatially, the expression of the fusion gene containing 421 basepairs of the promoter was localized to the dorsal region of the embryo in a pattern that was almost identical to that detected with the endogenous transcripts. Therefore, the elements involved in spatial and temporal regulation of the xnf7 gene during development were contained within 421 basepairs upstream of the transcriptional initiation site. Future work will further define the elements involved in the spatial and temporal regulation and the trans-factors that interact with them. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Wilms' tumor 1 gene (WT1) encodes a zinc-finger transcription factor and is expressed in urogenital, hematopoietic and other tissues. It is expressed in a temporal and spatial manner in both embryonic and adult stages. To obtain a better understanding of the biological function of WT1, we studied two aspects of WT1 regulation: one is the identification of tissue-specific cis-regulatory elements that regulate its expression, the other is the downstream genes which are modulated by WT1.^ My studies indicate that in addition to the promoter, other regulatory elements are required for the tissue specific expression of this gene. A 259-bp hematopoietic specific enhancer in intron 3 of the WT1 gene increased the transcriptional activity of the WT1 promoter by 8- to 10-fold in K562 and HL60 cells. Sequence analysis revealed both GATA and c-Myb motifs in the enhancer fragment. Mutation of the GATA motif decreased the enhancer activity by 60% in K562 cells. Electrophoretic mobility shift assays showed that both GATA-1 and GATA-2 proteins in K562 nuclear extracts bind to this motif. Cotransfection of the enhancer containing reporter construct with a GATA-1 or GATA-2 expression vector showed that both GATA-1 and GATA-2 transactivated this enhancer, increasing the CAT reporter activity 10-15 fold and 5-fold respectively. Similar analysis of the c-Myb motif by cotransfection with the enhancer CAT reporter construct and a c-Myb expression vector showed that c-Myb transactivated the enhancer by 5-fold. A DNase I-hypersensitive site has been identified in the 258 bp enhancer region. These data suggest that GATA-1 and c-Myb are responsible for the activity of this enhancer in hematopoietic cells and may bind to the enhancer in vivo. In the process of searching for cis-regulatory elements in transgenic mice, we have identified a 1.0 kb fragment that is 50 kb downstream from the promoter and is required for the central nervous system expression of WT1.^ In the search for downstream target genes of WT1, we noted that the proto-oncogene N-myc is coexpressed with the tumor suppressor gene WT1 in the developing kidney and is overexpressed in many Wilms' tumors. Sequence analysis revealed eleven consensus WT1 binding sites located in the 1 kb mouse N-myc promoter. We further showed that the N-myc promoter was down-regulated by WT1 in transient transfection assays. Electrophoretic mobility shift assays showed that oligonucleotides containing the WT1 motifs could bind WT1 protein. Furthermore, a Denys-Drash syndrome mutant of WT1, R394W, that has a mutation in the DNA binding domain, failed to repress the N-myc promoter. This suggests that the repression of the N-myc promoter is mediated by DNA binding of WT1. This finding helps to elucidate the relationship of WT1 and N-myc in tumorigenesis and renal development. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

STUDY OBJECTIVE Prior research has identified five common genetic variants associated with narcolepsy with cataplexy in Caucasian patients. To replicate and/or extend these findings, we have tested HLA-DQB1, the previously identified 5 variants, and 10 other potential variants in a large European sample of narcolepsy with cataplexy subjects. DESIGN Retrospective case-control study. SETTING A recent study showed that over 76% of significant genome-wide association variants lie within DNase I hypersensitive sites (DHSs). From our previous GWAS, we identified 30 single nucleotide polymorphisms (SNPs) with P < 10(-4) mapping to DHSs. Ten SNPs tagging these sites, HLADQB1, and all previously reported SNPs significantly associated with narcolepsy were tested for replication. PATIENTS AND PARTICIPANTS For GWAS, 1,261 narcolepsy patients and 1,422 HLA-DQB1*06:02-matched controls were included. For HLA study, 1,218 patients and 3,541 controls were included. MEASUREMENTS AND RESULTS None of the top variants within DHSs were replicated. Out of the five previously reported SNPs, only rs2858884 within the HLA region (P < 2x10(-9)) and rs1154155 within the TRA locus (P < 2x10(-8)) replicated. DQB1 typing confirmed that DQB1*06:02 confers an extraordinary risk (odds ratio 251). Four protective alleles (DQB1*06:03, odds ratio 0.17, DQB1*05:01, odds ratio 0.56, DQB1*06:09 odds ratio 0.21, DQB1*02 odds ratio 0.76) were also identified. CONCLUSION An overwhelming portion of genetic risk for narcolepsy with cataplexy is found at DQB1 locus. Since DQB1*06:02 positive subjects are at 251-fold increase in risk for narcolepsy, and all recent cases of narcolepsy after H1N1 vaccination are positive for this allele, DQB1 genotyping may be relevant to public health policy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Type I interferons (IFNs), mainly IFN-α/β play a crucial role in innate defense against viruses. In addition to their direct antiviral activity, type I IFNs have antitumoral and immunomodulatory effects. Although all cells are virtually able to induce IFN-α, the plasmacytoid dendritic cell (pDC) subset represents the ultimate producers of IFN-α as well as other proinflammatory cytokines. Due to the specific expression of TLR7 and TLR9 recognizing single-stranded (ss) RNA and unmethylated CpG motifs respectively, pDCs can secrete up to 1000 times more IFN-α than any cellular types. Additionally, it is well known that several cytokines including type I and II IFNs, Flt3-L, IL-4 and GM-CSF favor pDC-derived IFN-α responses to unmethylated CpG motifs. In a first step, we aimed to characterize and clarify the interactions of two porcine viruses with pDCs. The double-stranded DNA replicative forms of porcine circovirus type 2 (PCV2) were demonstrated to inhibit CpG-induced IFN- α by pDCs. Our study showed that none of the cytokines known to enhance pDC responsiveness can counter-regulate the PCV2-mediated inhibition of IFN-α induced by CpG, albeit IFN-γ significantly reduced the level of inhibition. Interestingly, the presence of IFN-γ enabled pDCs to induce IFN-α to low doses of PCV2. We also noted that after DNase treatment, PCV2 preparations were still able to stimulate pDCs. These data suggest that encapsulated viral ssDNA promotes the induction of IFN-α in pDCs treated with IFN-γ whereas free DNA, presumably as double-stranded forms, was responsible for inhibiting pDC responses. Regarding PRRSV, it has been reported that North American isolates did not induce and even inhibited IFN-α response in pDCs. However, PRRSV infection was also shown to lead to an induction of IFN-α in the serum and in the lungs suggesting that certain cells are responsive to the virus. Contrasting to previous reports we found that numerous PRRSV isolates directly induced IFN-α in pDCs. This response was still observed after UV-inactivation of viruses and required TLR7 signaling. The inhibition of CpG-induced IFN-α was weak and strain dependent, again contrasting with a previous report. We also observed that IFN-γ and IL-4 enhanced IFN-α response to two prototype strains, VR-2332 and LVP23. In summary, we demonstrated that both PCV2 and PRRSV promote IFN-α secretion in pDCs in vitro suggesting that IFN-α detected in PCV2- or PRRSV-infected animal might originate from pDCs. On the other hand, PRRSV replication is restricted to the macrophage (MΦ) lineage. These innate immune cells represent a heterogeneous population which can be induce to “classical” (M1) and “alternative” (M2) activated MΦ acquiring inflammatory or “wound-healing” functional properties, respectively. Nonetheless, little is known about the effect of polarization into M1 or M2 and the susceptibility of these cells to PRRSV. Thus, we examined the impact of cytokine on MΦ polarization into M1 or M2. Infections of these cells by several PRRSV isolates enabled the discrimination of PRRSV isolate in a genotype- and irulencedependent manner in M1 and IFN-β-activated MΦ. In contrast, the expression of PRRSV nucleocapsid in M2 or inactivated MΦ was indistinguishable among the PRRSV isolates tested. In the last part of my Thesis, we investigated the influence of three synthetic porcine cathelicidin peptides for their ability to deliver nucleic acid to pDCs. We reported that all cathelicidins tested can complex and quickly deliver nucleic acids resulting in IFN-α induction. Moreover, we show that the typical α- helical amphipathic conformation is required to mediate killing of bacteria but not for inducing IFN-α secretion by pDCs. Furthermore, we found that E.coli treated with one of these cathelicidins is able to induce significantly higher levels of IFN-α compared to a non-sense version of the peptide. These data suggest that cathelicidins could influence the immune response in a two-step process. First, these peptides target bacteria leading to cell lysis. In turn, cathelicidins form complexes and deliver extracellular microbial nucleic acids released into pDCs. These pDC-derived IFN-α responses could be of particular relevance in driving the adaptive immune responses against microbial infections.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND Acute thrombotic microangiopathies (TMAs) are characterized by excessive microvascular thrombosis and are associated with markers of neutrophil extracellular traps (NETs) in plasma. NETs are composed of DNA fibers and promote thrombus formation through the activation of platelets and clotting factors. OBJECTIVE The efficient removal of NETs may be required to prevent excessive thrombosis such as in TMAs. To test this hypothesis, we investigated whether TMAs are associated with a defect in the degradation of NETs. APPROACH AND RESULTS We show that NETs generated in vitro were efficiently degraded by plasma from healthy donors. However, NETs remained stable after exposure to plasma from TMA patients. The inability to degrade NETs was linked to a reduced DNase activity in TMA plasma. Plasma DNase1 was required for efficient NET-degradation and TMA plasma showed decreased levels of this enzyme. Supplementation of TMA plasma with recombinant human DNase1 restored NET-degradation activity. CONCLUSIONS Our data indicates that DNase1-mediated degradation of NETs is impaired in patients with TMAs. The role of plasma DNases in thrombosis is, as of yet, poorly understood. Reduced plasma DNase1 activity may cause the persistence of pro-thrombotic NETs and thus promote microvascular thrombosis in TMA patients. This article is protected by copyright. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Triplex-forming oligodeoxynucleotide 15mers, designed to bind in the antiparallel triple-helical binding motif, containing single substitutions (Z) of the four isomeric alphaN(7)-, betaN(7)-, alphaN(9)- and betaN(9)-2-aminopurine (ap)-deoxyribonucleosides were prepared. Their association with double-stranded DNA targets containing all four natural base pairs (X-Y) opposite the aminopurine residues was determined by quantitative DNase I footprint titration in the absence of monovalent metal cations. The corresponding association constants were found to be in a rather narrow range between 1.0 x 10(6) and 1.3 x 10(8) M(-1). The following relative order in Z x X-Y base-triple stabilities was found: Z = alphaN(7)ap: T-A > A-T> C-G approximately G-C; Z = betaN(7)ap: A-T > C-G > G-C > T-A; Z = alphaN(9)ap: A-T = G-C > T-A > C-G; and Z = betaN(9)ap: G-C > A-T > C-G > T-A

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: Clostridium perfringens type A food poisoning is caused by enterotoxigenic C. perfringens type A isolates that typically possess high spore heat-resistance. The molecular basis for C. perfringens spore heat-resistance remains unknown. In the current study, we investigated the role of small, acid-soluble spore proteins (SASPs) in heat-resistance of spores produced by C. perfringens food poisoning isolates. RESULTS: Our current study demonstrated the presence of all three SASP-encoding genes (ssp1, 2 and 3) in five surveyed C. perfringens clinical food poisoning isolates. beta-Glucuronidase assay showed that these ssp genes are expressed specifically during sporulation. Consistent with these expression results, our study also demonstrated the production of SASPs by C. perfringens food poisoning isolates. When the heat sensitivities of spores produced by a ssp3 knock-out mutant of a C. perfringens food poisoning isolate was compared with that of spores of the wild-type strain, spores of the ssp3 mutant were found to exhibit a lower decimal reduction value (D value) at 100 degrees C than exhibited by the spores of wild-type strain. This effect was restored by complementing the ssp3 mutant with a recombinant plasmid carrying wild-type ssp3, suggesting that the observed differences in D values between spores of wild-type versus ssp3 mutant was due to the specific inactivation of ssp3. Furthermore, our DNA protection assay demonstrated that C. perfringens SASPs can protect DNA from DNase I digestion. CONCLUSION: The results from our current study provide evidences that SASPs produced by C. perfringens food poisoning isolates play a role in protecting their spores from heat-damage, which is highly significant and relevant from a food safety perspective. Further detailed studies on mechanism of action of SASPs from C. perfringens should help in understanding the mechanism of protection of C. perfringens spores from heat-damage.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The occurrence of group G streptococci in cats and evaluation of the recovered organisms as potential human pathogens was investigated. Throat swabs were obtained from 89 cats (47 males and 42 females) and vaginal swabs from 39 female cats. Eighty-three of the examined cats were housed in individual cages at a University Animal Care Facility. Six cats, 2 mature males, 2 mature females and 2 young females were family pets in a rural area. Beta-hemolytic streptococci were recovered from 33 (37%) of the 89 cat throats cultured, and 27 (30.3%) were identified as group G. More males (34%) than females (24%) had throat cultures positive for group G. From the 39 vaginal cultures examined, 24 (61.5%) contained beta-hemolytic streptococci and 23 (58.9%) were identified as group G streptococci. Streptococci were not recovered from the vaginal cultures of the 5 females under 6 months of age.^ Thirty one group G streptococci isolated from cats were compared with 37 isolates of group G obtained from humans (health status or site of origin unknown). More group G cat isolates (81%) produced deoxyribonuclease (DNase) than did the human isolates (36%). The proportion of cat throat and vaginal isolates producing DNase was the same. Production of nicotinamide adenine dinucleotide glycohydrolase (NADase) by group G isolates of human origin was 70%, cat throat isolates 53% and cat vaginal isolates 37%. The Serum Opacity Factor was present in 73% of the cat throat isolates of group G, 43.7% of the cat vaginal isolates and 58.6% of the human isolates. Possession of an anti-phagocytic factor (M protein like substance) demonstrated by the ability to multiply in fresh human blood was greater in the group G from cat throats (46.7%) than from cat vagina (37.5%) or from the human isolates (13.5%). Many of the biochemical characteristics of the group G streptococci of cat origin were more similar to the biochemical characteristics of group A streptococci, than to the characteristics of group G of human origin. The group G streptococci, found in a large number of cats, could be potential human pathogens, as their physiological and biological characteristics are very similar to those of group A, a known human pathogen. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The formation of triple helical, or triplex DNA has been suggested to occur in several cellular processes such as transcription, replication, and recombination. Our laboratory previously found proteins in HeLa nuclear extracts and in S. cerevisiae whole cell extracts that avidly bound a Purine-motif (Pu) triplex probe in gel shift assays, or EMSA. In order to identify a triplex DNA-binding protein, we used conventional and affinity chromatography to purify the major Pu triplex-binding protein in yeast. Peptide microsequencing and data base searches identified this protein as the product of the STM1 gene. Confirmation that Stm1p is a Pu triplex-binding protein was obtained by EMSA using both recombinant Stm1p and whole cell extracts from stm1Δ yeast. Stm1p had previously been identified as G4p2, a G-quartet DNA- and RNA-binding protein. To study the cellular role and identify the nucleic acid ligand of Stm1p in vivo, we introduced an HA epitope at either the N- or C-terminus of Stm1p and performed immunoprecipitations with the HA.11 mAb. Using peptide microsequencing and Northern analysis, we positively identified a subset of both large and small subunit ribosomal proteins and all four rRNAs as associating with Stm1p. DNase I treatment did not affect the association of Stm1p with ribosomal components, but RNase A treatment abolished the association with all ribosomal proteins and RNA, suggesting this association is RNA-dependent. Sucrose gradient fractionation followed by Western and EMSA analysis confirmed that Stm1p associates with intact 80S monosomes, but not polysomes. The presence of additional, unidentified RNA in the Stm1p-immunoprecipitate, and the absence of tRNAs and elongation factors suggests that Stm1p binds RNA and could be involved in the regulation of translation. Immunofluorescence microscopy data showed Stm1p to be located throughout the cytoplasm, with a specific movement to the bud during the G2 phase of the cell cycle. A dramatically flocculent, large cell phenotype is observed when Stm1p has a C-terminal HA tag in a protease-deficient strain background. When STM1 is deleted in this background, the same phenotype is not observed and the deletion yeast grow very slowly compared to the wild-type. These data suggest that STM1 is not essential, but plays a role in cell growth by interacting with an RNP complex that may contain G*G multiplex RNA. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

ALL1, the human homologue of Drosophila trithorax, is directly involved in human acute leukemias associated with abnormalities at 11q23. Using the differential display method, we isolated a gene that is down-regulated in All1 double-knockout mouse embryonic stem (ES) cells. The gene, designated ARP1 (also termed RIEG, Ptx2, or Otlx2), is a member of a family of homeotic genes containing a short motif shared with several homeobox genes. Using a bacterially synthesized All1 polypeptide encompassing the AT-hook motifs, we identified a 0.5-kb ARP1 DNA fragment that preferentially bound to the polypeptide. Within this DNA, a region of ≈100 bp was protected by the polypeptide from digestion with ExoIII and DNase I. Whole-mount in situ hybridization to early mouse embryos of 9.5–10.5 days indicated a complex pattern of Arp1 expression spatially overlapping with the expression of All1. Although the ARP1 gene is expressed strongly in bone marrow cells, no transcripts were detected in six leukemia cell lines with 11q23 translocations. These results suggest that ARP1 is up-regulated by the All1 protein, possibly through direct interaction with an upstream DNA sequence of the former. The results are also consistent with the suggestion that ALL1 chimeric proteins resulting from 11q23 abnormalities act in a dominant negative fashion.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Extensive studies of the β-phaseolin (phas) gene in transgenic tobacco have shown that it is highly active during seed embryogenesis but is completely silent in leaf and other vegetative tissues. In vivo footprinting revealed that the lack of even basal transcriptional activity in vegetative tissues is associated with the presence of a nucleosome that is rotationally positioned with base pair precision over three phased TATA boxes present in the phas promoter. Positioning is sequence-dependent because an identical rotational setting is obtained upon nucleosome reconstitution in vitro. A comparison of DNase I and dimethyl sulfate footprints in vivo and in vitro strongly suggests that this repressive chromatin architecture is remodeled concomitant with gene activation in the developing seed. This leads to the disruption of histone-mediated DNA wrapping and the assembly of the TATA boxes into a transcriptionally competent nucleoprotein complex.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The assembly and composition of human excision nuclease were investigated by electrophoretic mobility shift assay and DNase I footprinting. Individual repair factors or any combination of up to four repair factors failed to form DNA–protein complexes of high specificity and stability. A stable complex of high specificity can be detected only when XPA/RPA, transcription factor IIH, XPC⋅HHR23B, and XPG and ATP are present in the reaction mixture. The XPF⋅ERCC1 heterodimer changes the electrophoretic mobility of the DNA–protein complex formed with the other five repair factors, but it does not confer additional specificity. By using proteins with peptide tags or antibodies to the repair factors in electrophoretic mobility shift assays, it was found that XPA, replication protein A, transcription factor IIH, XPG, and XPF⋅excision repair cross-complementing 1 but not XPC⋅HHR23B were present in the penultimate and ultimate dual incision complexes. Thus, it appears that XPC⋅HHR23B is a molecular matchmaker that participates in the assembly of the excision nuclease but is not present in the ultimate dual incision complex. The excision nuclease makes an assymmetric DNase I footprint of ≈30 bp around the damage and increases the DNase I sensitivity of the DNA on both sides of the footprint.