A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

A chronicle of the kings of England. From the time of the Romans government, unto the death of King James. Containing all passages of state and church, with all other observations proper for a chronicle ... Whereunto is added, the reign of King Charles the first, and the first thirteen years of his sacred majesty, King Charles the second ... All which additions are revised in this eighth impression, and freed from many errors and mistakes of the former editions.

The histories of Charles the first and Charles the second are by Edward Phillips; the account of the restoration is by Sir Thomas Clarges--Dict. of Nat. Biog.

Analyse des procès-verbaux des séances du 22 décembre 1800 au 20 novembre, 1874 / Publiée en exaecution de la délibération du 27 avril 1877.

t.1. 1800-1840 -- t.2. 1841-1870 -- t.3. 1871-1874 et Table des matières A-C -- T.4. Table des matières D à Z.

The Illinois program for comprehensive solar energy legislation /

Includes bibliographical references.

The potential economic impact of solar heated residential structures in Illinois, 1976-2000 /

Caption title.

Unser Märtyrer-präsident ... : Die Lebensgeschichte von Wm. McKinley, enthaltend seine Jugendzeit, seinen Wissendrang, seine glänzende Carriere im Bürgerkrieg, bericht über seine patriotischen Erfolge als Congressmitglied und als Gouverneur seines Staates, seine treffliche Administration als Präsident ... /

Captions for plates in English, German, and Swedish.

The history of the kingdom of Scotland, from Fergus the first king, to the commencement of the union of the two kingdoms of Scotland and England, in the sixth year of the reign of Our late Sovereign Queen Anne, anno 1707 ... To which is added, an account of the rebellion in Scotland in the year 1715 ... As also a description of the kingdom of Scotland ...

Bound in old calf, rebacked.

Über die theologische Grundlage aller philosophischen Systeme : vorgetragen zum Antritte des Rectorates der Ludwig-Maximilians-Universität am 29. November 1856

von Ernst von Lasaulx, D.Z. Rector

Active membrane transport and receptor proteins from bacteria

A general strategy for the expression of bacterial membrane transport and receptor genes in Escherichia coli is described. Expression is amplified so that the encoded proteins comprise 5-35% of E. coli inner membrane protein. Depending upon their topology, proteins are produced with RGSH6 or a Strep tag at the C-terminus. These enable purification in mg quantities for crystallization and NMR studies. Examples of one nutrient uptake and one multidrug extrusion protein from Helicobacter pylori are described. This strategy is successful for membrane proteins from H. pylori, E. coli, Enterococcus faecalis, Bacillus subtilis, Staphylococcus aureus, Microbacterium liquefaciens, Brucella abortus, Brucella melitensis, Campylobacter jejuni, Neisseria meningitides, Streptomyces coelicolor and Rhodobacter sphaeroides. ©2005 Biochemical Society.

Differential patterns of activity and functional connectivity in emotion processing neural circuitry to angry and happy faces in adolescents with and without suicide attempt

Background - Neural substrates of emotion dysregulation in adolescent suicide attempters remain unexamined. Method - We used functional magnetic resonance imaging to measure neural activity to neutral, mild or intense (i.e. 0%, 50% or 100% intensity) emotion face morphs in two separate emotion-processing runs (angry and happy) in three adolescent groups: (1) history of suicide attempt and depression (ATT, n = 14); (2) history of depression alone (NAT, n = 15); and (3) healthy controls (HC, n = 15). Post-hoc analyses were conducted on interactions from 3 group × 3 condition (intensities) whole-brain analyses (p < 0.05, corrected) for each emotion run. Results - To 50% intensity angry faces, ATT showed significantly greater activity than NAT in anterior cingulate gyral–dorsolateral prefrontal cortical attentional control circuitry, primary sensory and temporal cortices; and significantly greater activity than HC in the primary sensory cortex, while NAT had significantly lower activity than HC in the anterior cingulate gyrus and ventromedial prefrontal cortex. To neutral faces during the angry emotion-processing run, ATT had significantly lower activity than NAT in the fusiform gyrus. ATT also showed significantly lower activity than HC to 100% intensity happy faces in the primary sensory cortex, and to neutral faces in the happy run in the anterior cingulate and left medial frontal gyri (all p < 0.006,corrected). Psychophysiological interaction analyses revealed significantly reduced anterior cingulate gyral–insula functional connectivity to 50% intensity angry faces in ATT v. NAT or HC. Conclusions - Elevated activity in attention control circuitry, and reduced anterior cingulate gyral–insula functional connectivity, to 50% intensity angry faces in ATT than other groups suggest that ATT may show inefficient recruitment of attentional control neural circuitry when regulating attention to mild intensity angry faces, which may represent a potential biological marker for suicide risk.

More lr saturated L∞ spaces

2000 Mathematics Subject Classification: 05D10, 46B03.

Growth rates and possible age of a North Pacific manganese nodule

The rate of accumulation of a ferromanganese coating on a fragment of pillow basalt was estimated using a variety of techniques. Unsupported 230 Th activity decrease in the oxide layer, K/A dating of the basalt, fission tracks dating of the glassy layer around the basalt, thickness of the palagonitization rind, and integrated 230 Th activity give ages from approximately 3 x 10-6 years to 5 x 10-3 years. Data suggest that the ferromanganese material formed rapidly (33 mm/10-6 years) and by hydrothermal or volcanic processes.

Diagnóstico del rendimiento académico de estudiantes de una escuela de educación superior en México

El objetivo del artículo es realizar un diagnóstico sobre la percepción de los factores que intervienen en el rendimiento académico de los estudiantes de cinco carreras universitarias en una escuela de educación superior en México, para así reconocer las áreas de oportunidad que permitan sugerir políticas y estrategias para elevar su rendimiento. Se utilizó una muestra de 1651 estudiantes, se obtuvieron los datos a partir de un cuestionario con treinta preguntas que estudian la percepción del rendimiento académico en escala tipo Likert. Se realizó un análisis factorial exploratorio que permitiera reducir los datos, facilitar la interpretación y validar el instrumento. Se identificaron tres factores: a) el rol de los profesores, b) la evaluación y c) la motivación de los estudiantes. Se llevó a cabo un análisis comparativo por carrera. Se encontró que los estudiantes perciben que la mayoría de los maestros no se preocupan por la condición de los jóvenes en situación de reprobación. Además, casi no motivan y carecen de expresiones de sentimientos de orgullo por los logros académicos de los estudiantes. La mitad de los participantes piensa que los docentes no cubren el temario en su totalidad. Se detectó que los estudiantes poseen una alta motivación siendo esto positivo porque son alumnos dedicados y responsables. Se concluye realizando una serie de sugerencias y explicando las implicaciones que tiene este trabajo para las instituciones de educación superior.

Assessment of the EEE-4 oral test: a discourse analysis based on complex networks.

With the development of information technology, the theory and methodology of complex network has been introduced to the language research, which transforms the system of language in a complex networks composed of nodes and edges for the quantitative analysis about the language structure. The development of dependency grammar provides theoretical support for the construction of a treebank corpus, making possible a statistic analysis of complex networks. This paper introduces the theory and methodology of the complex network and builds dependency syntactic networks based on the treebank of speeches from the EEE-4 oral test. According to the analysis of the overall characteristics of the networks, including the number of edges, the number of the nodes, the average degree, the average path length, the network centrality and the degree distribution, it aims to find in the networks potential difference and similarity between various grades of speaking performance. Through clustering analysis, this research intends to prove the network parameters’ discriminating feature and provide potential reference for scoring speaking performance.