905 resultados para Combined Bending and Shear Actions
Resumo:
The effects of uniform straining and shearing on the stability of a surface quasi-geostrophic temperature filament are investigated. Straining is shown to stabilize perturbations for wide filaments but only for a finite time until the filament thins to a critical width, after which some perturbations can grow. No filament can be stabilized in practice, since there are perturbations that can grow large for any strain rate. The optimally growing perturbations, defined as solutions that reach a certain threshold amplitude first, are found numerically for a wide range of parameter values. The radii of the vortices formed through nonlinear roll-up are found to be proportional to θ/s, where θ is the temperature anomaly of the filament and s the strain rate, and are not dependent on the initial size of the filament. Shearing is shown to reduce the normal-mode growth rates, but it cannot stabilize them completely when there are temperature discontinuities in the basic state; smooth filaments can be stabilized completely by shearing and a simple scaling argument provides the shear rate required. Copyright © 2010 Royal Meteorological Society
Resumo:
Commercially supplied chicken breast muscle was subjected to simultaneous heat and pressure treatments. Treatment conditions ranged from ambient temperature to 70 °C and from 0.1 to 800 MPa, respectively, in various combinations. Texture profile analysis (TPA) of the treated samples was performed to determine changes in muscle hardness. At treatment temperatures up to and including 50 °C, heat and pressure acted synergistically to increase muscle hardness. However, at 60 and 70 °C, hardness decreased following treatments in excess of 200 MPa. TPA was performed on extracted myofibrillar protein gels that after treatment under similar conditions revealed similar effects of heat and pressure. Differential scanning calorimetry analysis of whole muscle samples revealed that at ambient pressure the unfolding of myosin was completed at 60 °C, unlike actin, which completely denatured only above 70 °C. With simultaneous pressure treatment at >200 MPa, myosin and actin unfolded at 20 °C. Unfolding of myosin and actin could be induced in extracted myofibrillar protein with simultaneous treatment at 200 MPa and 40 °C. Electrophoretic analysis indicated high pressure/temperature regimens induced disulfide bonding between myosin chains.
Resumo:
Time-resolved kinetic studies of the reaction of silylene, SiH2, with H2O and with D2O have been carried out in the gas phase at 297 K and at 345 K, using laser flash photolysis to generate and monitor SiH2. The reaction was studied independently as a function of H2O (or D2O) and SF6 (bath gas) pressures. At a fixed pressure of SF6 (5 Torr), [SiH2] decay constants, k(obs), showed a quadratic dependence on [H2O] or [D2O]. At a fixed pressure of H2O or D2O, k(obs) Values were strongly dependent on [SF6]. The combined rate expression is consistent with a mechanism involving the reversible formation of a vibrationally excited zwitterionic donor-acceptor complex, H2Si...OH2 (or H2Si...OD2). This complex can then either be stabilized by SF6 or it reacts with a further molecule of H2O (or D2O) in the rate-determining step. Isotope effects are in the range 1.0-1.5 and are broadly consistent with this mechanism. The mechanism is further supported by RRKM theory, which shows the association reaction to be close to its third-order region of pressure (SF6) dependence. Ab initio quantum calculations, carried out at the G3 level, support the existence of a hydrated zwitterion H2Si...(OH2)(2), which can rearrange to hydrated silanol, with an energy barrier below the reaction energy threshold. This is the first example of a gas-phase-catalyzed silylene reaction.
Resumo:
The structure and flow behaviour of binary mixtures of Pluronic block copolymers P85 and P123 is investigated by small-angle scattering, rheometry and mobility tests. Micelle dimensions are probed by dynamic light scattering. The micelle hydrodynamic radius for the 50/50 mixture is larger than that for either P85 or P123 alone, Clue to the formation of mixed micelles with a higher association number. The phase diagram for 50/50 mixtures contains regions Of Cubic and hexagonal phases similar to those for the parent homopolymers, however the region of stability of the cubic phase is enhanced at low temperature and concentrations above 40 wt%. This is ascribed to favourable packing of the mixed micelles containing core blocks with two different chain lengths, but similar corona chain lengths. The shear flow alignment of face-centred cubic and hexagonal phases is probed by in situ small-angle X-ray or neutron scattering with simultaneous rheology. The hexagonal phase can be aligned using steady shear in a Couette geometry, however the high modulus Cubic phase cannot be aligned well in this way. This requires the application of oscillatory shear or compression. (C) 2008 Elsevier Inc. All rights reserved.
Resumo:
The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The structure of the chiral kinked Pt{531} surface has been determined by low-energy electron diffraction intensity-versus-energy (LEED-IV) analysis and density functional theory (DFT). Large contractions and expansions of the vertical interlayer distances with respect to the bulk-terminated surface geometry were found for the first six layers (LEED: d(12) = 0.44 angstrom, d(23) = 0.69 angstrom, d(34) = 0.49 angstrom, d(45) = 0.95 angstrom, d(56) = 0.56 angstrom; DFT: d(12) = 0.51 angstrom, d(23) = 0.55 angstrom, d(34) = 0.74 angstrom, d(45) = 0.78 angstrom, d(56) = 0.63 angstrom; d(bulk) = 0.66 angstrom). Energy-dependent cancellations of LEED spots over unusually large energy ranges, up to 100 eV, can be explained by surface roughness and reproduced by applying a model involving 0.25 ML of vacancies and adatoms in the scattering calculations. The agreement between the results from LEED and DFT is not as good as in other cases, which could be due to this roughness of the real surface.
Resumo:
Measured process data normally contain inaccuracies because the measurements are obtained using imperfect instruments. As well as random errors one can expect systematic bias caused by miscalibrated instruments or outliers caused by process peaks such as sudden power fluctuations. Data reconciliation is the adjustment of a set of process data based on a model of the process so that the derived estimates conform to natural laws. In this paper, techniques for the detection and identification of both systematic bias and outliers in dynamic process data are presented. A novel technique for the detection and identification of systematic bias is formulated and presented. The problem of detection, identification and elimination of outliers is also treated using a modified version of a previously available clustering technique. These techniques are also combined to provide a global dynamic data reconciliation (DDR) strategy. The algorithms presented are tested in isolation and in combination using dynamic simulations of two continuous stirred tank reactors (CSTR).
Resumo:
This contribution proposes a powerful technique for two-class imbalanced classification problems by combining the synthetic minority over-sampling technique (SMOTE) and the particle swarm optimisation (PSO) aided radial basis function (RBF) classifier. In order to enhance the significance of the small and specific region belonging to the positive class in the decision region, the SMOTE is applied to generate synthetic instances for the positive class to balance the training data set. Based on the over-sampled training data, the RBF classifier is constructed by applying the orthogonal forward selection procedure, in which the classifier's structure and the parameters of RBF kernels are determined using a PSO algorithm based on the criterion of minimising the leave-one-out misclassification rate. The experimental results obtained on a simulated imbalanced data set and three real imbalanced data sets are presented to demonstrate the effectiveness of our proposed algorithm.
Resumo:
The existence of a specialized imitation module in humans is hotly debated. Studies suggesting a specific imitation impairment in individuals with autism spectrum disorders (ASD) support a modular view. However, the voluntary imitation tasks used in these studies (which require socio-cognitive abilities in addition to imitation for successful performance) cannot support claims of a specific impairment. Accordingly, an automatic imitation paradigm (a ‘cleaner’ measure of imitative ability) was used to assess the imitative ability of 16 adults with ASD and 16 non-autistic matched control participants. Participants performed a prespecified hand action in response to observed hand actions performed either by a human or a robotic hand. On compatible trials the stimulus and response actions matched, while on incompatible trials the two actions did not match. Replicating previous findings, the Control group showed an automatic imitation effect: responses on compatible trials were faster than those on incompatible trials. This effect was greater when responses were made to human than to robotic actions (‘animacy bias’). The ASD group also showed an automatic imitation effect and a larger animacy bias than the Control group. We discuss these findings with reference to the literature on imitation in ASD and theories of imitation.
Resumo:
The adsorption of carbon monoxide on the Pt{110} surface at coverages of 0.5 ML and 1.0 ML was investigated using quantitative low-energy electron diffraction (LEED IV) and density-functional theory (DFT). At 0.5 ML CO lifts the reconstruction of the clean surface but does not form an ordered overlayer. At the saturation coverage, 1.0 ML, a well-ordered p(2×1) superstructure with glide line symmetry is formed. It was confirmed that the CO molecules adsorb on top of the Pt atoms in the top-most substrate layer with the molecular axes tilted by ±22° with respect to the surface normal in alternating directions away from the close packed rows of Pt atoms. This is accompanied by significant lateral shifts of 0.55 Å away from the atop sites in the same direction as the tilt. The top-most substrate layer relaxes inwards by −4% with respect to the bulk-terminated atom positions, while the consecutive layers only show minor relaxations. Despite the lack of long-range order in the 0.5 ML CO layer it was possible to determine key structural parameters by LEED IV using only the intensities of the integer-order spots. At this coverage CO also adsorbs on atop sites with the molecular axis closer to the surface normal (b10°). The average substrate relaxations in each layer are similar for both coverages and consistent with DFT calculations performed for a variety of ordered structures with coverages of 1.0 ML and 0.5 ML.