910 resultados para Cis-acting Elements


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The intracellular distribution of RNAs depends on interactions of cis-acting nuclear export elements or nuclear retention elements with trans-acting nuclear transport or retention factors. To learn about the relationship between export and retention, we isolated RNAs that are exported from nuclei of Xenopus laevis oocytes even when most RNA export is blocked by an inhibitor of Ran-dependent nucleocytoplasmic transport, the Matrix protein of vesicular stomatitis virus. Export of the selected RNAs is saturable and specific. When present in chimeric RNAs, the selected sequences acted like nuclear export elements in promoting efficient export of RNAs that otherwise are not exported; the pathway used for export of these chimeric RNAs is that used for the selected RNAs alone. However, these chimeric RNAs, unlike the selected RNAs, were not exported in the presence of Matrix protein; thus, the nonselected sequences can cause retention of the selected RNA sequences under conditions of impaired nucleocytoplasmic transport. We propose that most RNAs are transiently immobilized in the nucleus and that release of these RNAs is an essential and early step in export. Release correlates with functional Ran-dependent transport, and the lack of export of chimeric RNAs may result from interference with the Ran system.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Autonomously replicating sequence (ARS) elements, which function as the cis-acting chromosomal replicators in the yeast Saccharomyces cerevisiae, depend upon an essential copy of the 11-bp ARS consensus sequence (ACS) for activity. Analysis of the chromosome III replicator ARS309 unexpectedly revealed that its essential ACS differs from the canonical ACS at two positions. One of the changes observed in ARS309 inactivates other ARS elements. This atypical ACS binds the origin recognition complex efficiently and is required for chromosomal replication origin activity. Comparison of the essential ACS of ARS309 with the essential regions of other ARS elements revealed an expanded 17-bp conserved sequence that efficiently predicts the essential core of ARS elements.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Nuclear matrix binding assays (NMBAs) define certain DNA sequences as matrix attachment regions (MARs), which often have cis-acting epigenetic regulatory functions. We used NMBAs to analyze the functionally important 15q11-q13 imprinting center (IC). We find that the IC is composed of an unusually high density of MARs, located in close proximity to the germ line elements that are proposed to direct imprint switching in this region. Moreover, we find that the organization of MARs is the same at the homologous mouse locus, despite extensive divergence of DNA sequence. MARs of this size are not usually associated with genes but rather with heterochromatin-forming areas of the genome. In contrast, the 15q11-q13 region contains multiple transcribed genes and is unusual for being subject to genomic imprinting, causing the maternal chromosome to be more transcriptionally silent, methylated, and late replicating than the paternal chromosome. We suggest that the extensive MAR sequences at the IC are organized as heterochromatin during oogenesis, an organization disrupted during spermatogenesis. Consistent with this model, multicolor fluorescence in situ hybridization to halo nuclei demonstrates a strong matrix association of the maternal IC, whereas the paternal IC is more decondensed, extending into the nuclear halo. This model also provides a mechanism for spreading of the imprinting signal, because heterochromatin at the IC on the maternal chromosome may exert a suppressive position effect in cis. We propose that the germ line elements at the 15q11-q13 IC mediate their effects through the candidate heterochromatin-forming DNA identified in this study.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Small nucleolar RNAs (snoRNAs) are a large family of eukaryotic RNAs that function within the nucleolus in the biogenesis of ribosomes. One major class of snoRNAs is the box C/D snoRNAs named for their conserved box C and box D sequence elements. We have investigated the involvement of cis-acting sequences and intranuclear structures in the localization of box C/D snoRNAs to the nucleolus by assaying the intranuclear distribution of fluorescently labeled U3, U8, and U14 snoRNAs injected into Xenopus oocyte nuclei. Analysis of an extensive panel of U3 RNA variants showed that the box C/D motif, comprised of box C′, box D, and the 3′ terminal stem of U3, is necessary and sufficient for the nucleolar localization of U3 snoRNA. Disruption of the elements of the box C/D motif of U8 and U14 snoRNAs also prevented nucleolar localization, indicating that all box C/D snoRNAs use a common nucleolar-targeting mechanism. Finally, we found that wild-type box C/D snoRNAs transiently associate with coiled bodies before they localize to nucleoli and that variant RNAs that lack an intact box C/D motif are detained within coiled bodies. These results suggest that coiled bodies play a role in the biogenesis and/or intranuclear transport of box C/D snoRNAs.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

It has been suggested that delayed DNA replication underlies fragility at common human fragile sites, but specific sequences responsible for expression of these inducible fragile sites have not been identified. One approach to identify such cis-acting sequences within the large nonexonic regions of fragile sites would be to identify conserved functional elements within orthologous fragile sites by interspecies sequence comparison. This study describes a comparison of orthologous fragile regions, the human FRA3B/FHIT and the murine Fra14A2/Fhit locus. We sequenced over 600 kbp of the mouse Fra14A2, covering the region orthologous to the fragile epicenter of FRA3B, and determined the Fhit deletion break points in a mouse kidney cancer cell line (RENCA). The murine Fra14A2 locus, like the human FRA3B, was characterized by a high AT content. Alignment of the two sequences showed that this fragile region was stable in evolution despite its susceptibility to mitotic recombination on inhibition of DNA replication. There were also several unusual highly conserved regions (HCRs). The positions of predicted matrix attachment regions (MARs), possibly related to replication origins, were not conserved. Of known fragile region landmarks, five cancer cell break points, one viral integration site, and one aphidicolin break cluster were located within or near HCRs. Thus, comparison of orthologous fragile regions has identified highly conserved sequences with possible functional roles in maintenance of fragility.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Two important signaling systems involved in the growth and development of plants, those triggered by the photoreceptor phytochrome and the hormone abscisic acid (ABA), are involved in the regulation of expression of the NPR1 gene of Lemna gibba. We previously demonstrated that phytochrome action mediates changes in ABA levels in L. gibba, correlating with changes in gene expression evoked by stimulation of the phytochrome system. We have now further characterized phytochrome- and ABA-mediated regulation of L. gibba NPR1 gene expression using a transient particle bombardment assay, demonstrating that regulatory elements controlling responses to both stimuli reside within 156 nucleotides upstream of the transcription start. Linker scan (LS) analysis of the region from −156 to −70 was used to identify two specific requisite and nonredundant cis-acting promoter elements between −143 to −135 (LS2) and −113 to −101 (LS5). Mutation of either of these elements resulted in a coordinate loss of regulation by phytochrome and ABA. This suggests that, unlike the L. gibba Lhcb2*1 promoter, in which phytochrome and ABA regulatory elements are separable, the phytochrome response of the L. gibba NPR1 gene can be attributed to alterations in ABA levels.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The human inducible nitric oxide synthase (hiNOS) gene is expressed in several disease states and is also important in the normal immune response. Previously, we described a cytokine-responsive enhancer between −5.2 and −6.1 kb in the 5′-flanking hiNOS promoter DNA, which contains multiple nuclear factor κβ (NF-κB) elements. Here, we describe the role of the IFN-Jak kinase-Stat (signal transducer and activator of transcription) 1 pathway for regulation of hiNOS gene transcription. In A549 human lung epithelial cells, a combination of cytokines tumor necrosis factor-α, interleukin-1β, and IFN-γ (TNF-α, IL-1β, and IFN-γ) function synergistically for induction of hiNOS transcription. Pharmacological inhibitors of Jak2 kinase inhibit cytokine-induced Stat 1 DNA-binding and hiNOS gene expression. Expression of a dominant-negative mutant Stat 1 inhibits cytokine-induced hiNOS reporter expression. Site-directed mutagenesis of a cis-acting DNA element at −5.8 kb in the hiNOS promoter identifies a bifunctional NF-κB/Stat 1 motif. In contrast, gel shift assays indicate that only Stat 1 binds to the DNA element at −5.2 kb in the hiNOS promoter. Interestingly, Stat 1 is repressive to basal and stimulated iNOS mRNA expression in 2fTGH human fibroblasts, which are refractory to iNOS induction. Overexpression of NF-κB activates hiNOS promoter–reporter expression in Stat 1 mutant fibroblasts, but not in the wild type, suggesting that Stat 1 inhibits NF-κB function in these cells. These results indicate that both Stat 1 and NF-κB are important in the regulation of hiNOS transcription by cytokines in a complex and cell type-specific manner.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Human hepatitis B virus genome encodes a protein, termed HBx, that is widely recognized as a transcriptional transactivator. While HBx does not directly bind cis-acting transcriptional control elements, it has been shown to associate with cellular proteins that bind DNA. Because HBx transactivated a large number of viral/cellular transcriptional control elements, we looked for its targets within the components of the basal transcriptional machinery. This search led to the identification of its interactions with TFIIH. Here, we show that HBx interacts with yeast and mammalian TFIIH complexes both in vitro and in vivo. These interactions between HBx and the components of TFIIH are supported by several lines of evidence including results from immunoprocedures and direct methods of measuring interactions. We have identified ERCC3 and ERCC2 DNA helicase subunits of holoenzyme TFIIH as targets of HBx interactions. Furthermore, the DNA helicase activity of purified TFIIH from rat liver and, individually, the ERCC2 component of TFIIH is stimulated in the presence of HBx. These observations suggest a role for HBx in transcription and DNA repair.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

It is now well understood that chromatin structure is perturbed in the neighborhood of expressed genes. This is most obvious in the neighborhood of promoters and enhancers, where hypersensitivity to nucleases marks sites that no longer carry canonical nucleosomes, and to which transcription factors bind. To study the relationship between transcription factor binding and the generation of these hypersensitive regions, we mutated individual cis-acting regulatory elements within the enhancer that lies between the chicken beta- and epsilon-globin genes. Constructions carrying the mutant enhancer were introduced by stable transformation into an avian erythroid cell line. We observed that weakening the enhancer resulted in creation of two classes of site: those still completely accessible to nuclease attack and those that were completely blocked. This all-or-none behavior suggests a mechanism by which chromatin structure can act to sharpen the response of developmental systems to changing concentrations of regulatory factors. Another problem raised by chromatin structure concerns the establishment of boundaries between active and inactive chromatin domains. We have identified a DNA element at the 5' end of the chicken beta-globin locus, near such a boundary, that has the properties of an insulator; in test constructions, it blocks the action of an enhancer on a promoter when it is placed between them. We describe the properties and partial dissection of this sequence. A third problem is posed by the continued presence of nucleosomes on transcribed genes, which might prevent the passage of RNA polymerase. We show, however, that a prokaryotic polymerase can transcribe through a histone octamer on a simple chromatin template. The analysis of this process reveals that an octamer is capable of transferring from a position in front of the polymerase to one behind, without ever losing its attachment to the DNA.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Kinetochores are DNA-protein structures that assemble on centromeric DNA and attach chromosomes to spindle microtubules. Because of their simplicity, the 125-bp centromeres of Saccharomyces cerevisiae are particularly amenable to molecular analysis. Budding yeast centromeres contain three sequence elements of which centromere DNA sequence element III (CDEIII) appears to be particularly important. cis-acting mutations in CDEIII and trans-acting mutations in genes encoding subunits of the CDEIII-binding complex (CBF3) prevent correct chromosome transmission. Using temperature-sensitive mutations in CBF3 subunits, we show a strong correlation between DNA-binding activity measured in vitro and kinetochore activity in vivo. We extend previous findings by Goh and Kilmartin [Goh, P.-Y. & Kilmartin, J.V. (1993) J. Cell Biol. 121, 503-512] to argue that DNA-bound CBF3 may be involved in the operation of a mitotic checkpoint but that functional CBF3 is not required for the assembly of a bipolar spindle.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Thesis (Ph.D.)--University of Washington, 2016-04

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The thiol tripeptides, glutathione (GSH) and homoglutathione (hGSH), perform multiple roles in legumes, including protection against toxicity of free radicals and heavy metals. The three genes involved in the synthesis of GSH and hGSH in the model legume, Lotus japonicus, have been fully characterized and appear to be present as single copies in the genome. The gamma-glutamylcysteine synthetase (gammaecs) gene was mapped on the long arm of chromosome 4 (70.0 centimorgans [cM]) and consists of 15 exons, whereas the glutathione synthetase (gshs) and homoglutathione synthetase (hgshs) genes were mapped on the long arm of chromosome 1 (81.3 cM) and found to be arranged in tandem, with a separation of approximately 8 kb. Both genes consist of 12 exons of exactly the same size (except exon 1, which is similar). Two types of transcripts were detected for the gshs gene, which putatively encode proteins localized in the plastids and cytosol. Promoter regions contain cis-acting regulatory elements that may be involved in the plant's response to light, hormones, and stress. Determination of transcript levels, enzyme activities, and thiol contents in nodules, roots, and leaves revealed that gammaecs and hgshs are expressed in all three plant organs, whereas gshs is significantly functional only in nodules. This strongly suggests an important role of GSH in the rhizobia-legume symbiosis.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

In vitro evolution imitates the natural evolution of genes and has been very successfully applied to the modification of coding sequences, but it has not yet been applied to promoter sequences. We propose an alternative method for functional promoter analysis by applying an in vitro evolution scheme consisting of rounds of error-prone PCR, followed by DNA shuffling and selection of mutant promoter activities. We modified the activity in embryogenic sugarcane cells of the promoter region of the Goldfinger isolate of banana streak virus and obtained mutant promoter sequences that showed an average mutation rate of 2.5% after applying one round of error-prone PCR and DNA shuffling. Selection and sequencing of promoter sequences with decreased or unaltered activity allowed us to rapidly map the position of one cis-acting element that influenced promoter activity in embryogenic sugarcane cells and to discover neutral mutations that did not affect promoter Junction. The selective-shotgun approach of this promoter analysis method immediately after the promoter boundaries have been defined by 5' deletion analysis dramatically reduces the labor associated with traditional linker-scanning deletion analysis to reveal the position of functional promoter domains. Furthermore, this method allows the entire promoter to be investigated at once, rather than selected domains or nucleotides, increasing the, prospect of identifying interacting promoter regions.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

We report the cloning and characterization in tobacco and Arabidopsis of a Vigna radiata L. (mung bean) promoter that controls the expression of VR-ACS1, an auxin-inducible ACC synthase gene. The VR-ACS1 promoter exhibits a very unusual behavior when studied in plants different from its original host, mung bean. GUS and luciferase in situ assays of transgenic plants containing VR-ACS1 promoter fusions show strong constitutive reporter gene expression throughout tobacco and Arabidopsis development. In vitro quantitative analyses show that transgenic plants harboring VR-ACS1 promoter-reporter constructs have on average 4-6 fold higher protein and activity levels of both reporter genes than plants transformed with comparable CaMV 35S promoter fusions. Similar transcript levels are present in VR-ACS1 and CaMV 35S promoter lines, suggesting that the high levels of gene product observed for the VR-ACS1 promoter are the combined result of transcriptional and translational activation. All tested deletion constructs retaining the core promoter region can drive strong constitutive promoter activity in transgenic plants. This is in contrast to mung bean, where expression of the native VR-ACS1 gene is almost undetectable in plants grown under normal conditions, but is rapidly and highly induced by a variety of stimuli. The constitutive behavior of the VR-ACS1 promoter in heterologous hosts is surprising, suggesting that the control mechanisms active in mung bean are impaired in tobacco and Arabidopsis. The 'aberrant' behavior of the VR-ACS1 promoter is further emphasized by its failure to respond to auxin and cycloheximide in heterologous hosts. VR-ACS1 promoter regulatory mechanisms seem to be different from all previously characterized auxin-inducible promoters.