THE IMPROVEMENT REGION IN RIDGE REGRESSION

One of the difficulties in the practical application of ridge regression is that, for a given data set, it is unknown whether a selected ridge estimator has smaller squared error than the least squares estimator. The concept of the improvement region is defined, and a technique is developed which obtains approximate confidence intervals for the value of ridge k which produces the maximum reduction in mean squared error. Two simulation experiments were conducted to investigate how accurate these approximate confidence intervals might be. ^

Policy analysis of iron micronutrient programs at USAID: The FANTA program in East Africa and the micronutrient initiative in Bihar region of India, using comparative cost effective and cost benefit analysis

It is the aim of this paper to examine iron supplementation programs which receive funding from United States Agency for International Development (USAID) but approach combating iron deficiency anemia in two vastly different ways. A brief literature review and background information on iron deficiencies and the differences between supplementation programs and micronutrient fortification were reviewed. Two non-governmental organizations (NGO's) were examined for this paper: the Food and Nutrition Technical Assistance II (FANTA) and the MicroNutrient Initiative. The FANTA program included an educational component to their supplementation program while the MicroNutrient Initiative solely used supplementation of micronutrients to their population. Methods used were cost-benefit analysis and cost-effectiveness analysis to determine the overall effectiveness of each program in reducing iron deficiency anemia in each population, if the added costs of the incentives in the FANTA program changed the cost-effectiveness of the program compared to the MicroNutrient Initiative program and to determine which program imparted the greatest benefit to each population by reducing the disease burden in Disability Adjusted Life Years (DALY). Results showed that the unit cost of the FANTA program per person was higher than the MicroNutrient Initiative program due to the educational component. The FANTA program reduced iron deficiency anemia less overall but cost less for each percentage point of anemia decreased in their respective populations. The MicroNutrient Initiative program had a better benefit cost ratio for the populations it served. The MicroNutrient Initiative's large scale program imparted many advantages by reducing unit cost per person and decreasing iron deficiency anemia. The FANTA program was more effective at decreasing iron deficiency anemia with less money: $5,660 per 1% decrease in iron deficiency anemia versus $18,450 per 1% decrease in iron deficiency anemia for the MicroNutrient Initiative program. ^ In conclusion, economic analysis cannot measure all of the benefits associated with programs that contain an educational component or large scale supplementation. More information needs to be gathered by NGOs and reported to USAID, such as detailed prevalence rates of iron deficiency anemia among the populations served. Further research is needed to determine the effects an educational supplementation program has on compliance rates of participants and motivation to participate in supplementation programs whose aim is to decrease iron deficiency anemia in a targeted population.^

Seroprevalence of Chagas' disease in Texas among shelter dogs in Houston and the Rio Grande Valley region and its implication for human infection

Chagas’ disease, also called American Trypanosomiasis, is a vector-borne disease caused by the protozoan parasite Trypanosoma cruzi. T. cruzi is spread by triatomine insects, commonly referred to as ‘kissing bugs.’ After the insect takes a blood meal from its animal or human host, it usually defecates near the bite wound. The parasite is present in the feces, and when rubbed into the bite wound or mucous membranes by the host, infection ensues. Chagas’ disease is highly endemic in Central and South America where it originated. Many people in these endemic areas live in poor conditions surrounded by animals, mainly dogs, that can serve as a possible link to human infection. In Chagas’ endemic countries, dogs can be used as a sentinel to infer risk for human infection. In Texas, the prevalence of Chagas’ and risk for human infection is largely unknown. This study aimed to determine the prevalence of Chagas’ disease in shelter dogs in Houston, Texas and the Rio Grande Valley region by using an immunochromatographic assay (Chagas’ Stat-Pak) to test for the presence of T. cruzi antibodies. Of the 822 samples tested, 26 were found to be positive (3.2%). In both locations, Chagas’ prevalence increased over time. This study found that dogs, especially strays, can serve as sentinels for disease activity. Public health authorities can implement this strategy to understand the level of Chagas’ activity in a defined geographic area and prevent human infection.^

Commercial Sexual Exploitation and Missing Children in the Coastal Region of Sao Paulo State, Brazil

The commercial sexual exploitation of children (CSEC) has emerged as one of the world’s most heinous crimes. The problem affects millions of children worldwide and no country or community is fully immune from its effects. This paper reports first generation research of the relationship that exists between CSEC and the phenomenon of missing children living in and around the coastal regions of the state of Sao Paulo, Brazil, the country’s richest State. Data are reported from interviews and case records of 64 children and adolescents, who were receiving care through a major youth serving non-governmental organization (NGO) located in the coastal city of Sao Vicente. Also, data about missing children and adolescents were collected from Police Reports – a total of 858 Police Reports. In Brazil, prostitution is not a crime itself, however, the exploitation of prostitution is a crime. Therefore, the police have no information about children or adolescents in this situation, they only have information about the clients and exploiters. Thus, this investigation sought to accomplish two objectives: 1) to establish the relationship between missing and sexual exploited children; and 2) to sensitize police and child-serving authorities in both the governmental and nongovernmental sectors to the nature, extent, and seriousness of many unrecognized cases of CSEC and missing children that come to their attention. The observed results indicated that the missing children police report are significantly underestimated. They do not represent the number of children that run away and/or are involved in commercial sexual exploitation.

Feminism, gender equity and sexual/reproductive health in the Middle East and North Africa (MENA) region

Sexual/reproductive/health and rights are crucial public health concerns that have been specifically integrated into the Millennium Development Goals to be accomplished by 2015. These issues are related to several health outcomes, including HIV/AIDS and gender-based violence (GBV) among women. The Middle East and North Africa (MENA) region comprises Algeria, Bahrain, Egypt, Iran, Iraq, Israel, Jordan, Kuwait, Lebanon, Libya, Morocco, Oman, Qatar, Saudi Arabia, Syria, Tunisia, United Arab Emirates (UAE), West Bank and Gaza (WBG), and Yemen. This region is primarily Arabic speaking (except for Israel and Iran), and primarily Muslim (except for Israel). Some traditional and cultural views and practices in this region engender gender inequalities, which manifest themselves in the economic, political and social spheres. HIV and gender-based violence in the region may be interlinked with gender inequalities which breed justification for partner violence and honour killings, and increase the chance that HIV will transform into an epidemic in the region if not addressed. A feminist framework, focused on economic, political and social empowerment for women would be useful to consider applying to sexual/reproductive health in the region.^

Post-transcriptional Regulation of Mammalian Gene Expression in Non-coding Region of Target RNA

Tumor Suppressor Candidate 2 (TUSC2) is a novel tumor suppressor gene located in the human chromosome 3p21.3 region. TUSC2 mRNA transcripts could be detected on Northern blots in both normal lung and some lung cancer cell lines, but no endogenous TUSC2 protein could be detected in a majority of lung cancer cell lines. Mechanisms regulating TUSC2 protein expression and its inactivation in primary lung cancer cells are largely unknown. We investigated the role of the 5’- and 3’-untranslated regions (UTRs) of the TUSC2 gene in the regulation of TUSC2 protein expression. We found that two small upstream open-reading frames (uORFs) in the 5’UTR of TUSC2 could markedly inhibit the translational initiation of TUSC2 protein by interfering with the “scanning” of the ribosome initiation complexes. Site-specific stem-loop array reverse transcription-polymerase chain reaction (SLA-RT-PCR) verified several micoRNAs (miRNAs) targeted at 3’UTR and directed TUSC2 cleavage and degradation. In addition, we used the established let-7-targeted high mobility group A2 (Hmga2) mRNA as a model system to study the mechanism of regulation of target mRNA by miRNAs in mammalian cells under physiological conditions. There have been no evidence of direct link between mRNA downregulation and mRNA cleavages mediated by miRNAs. Here we showed that the endonucleolytic cleavages on mRNAs were initiated by mammalian miRNA in seed pairing style. Let-7 directed cleavage activities among the eight predicted potential target sites have varied efficiency, which are influenced by the positional and the structural contexts in the UTR. The 5’ cleaved RNA fragments were mostly oligouridylated at their 3’-termini and accumulated for delayed 5’–3’ degradation. RNA fragment oligouridylation played important roles in marking RNA fragments for delayed bulk degradation and in converting RNA degradation mode from 3’–5’ to 5’–3’ with cooperative efforts from both endonucleolytic and non-catalytic miRNA-induced silencing complex (miRISC). Our findings point to a mammalian miRNA-mediated mechanism for the regulation of mRNA that miRNA can decrease target mRNA through target mRNA cleavage and uridine addition

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Mechanism of translationally coupled mRNA turnover mediated by c-fos protein-coding-region determinant

Proto-oncogene c-fos is a member of the class of early-response genes whose transient expression plays a crucial role in cell proliferation, differentiation, and apoptosis. Degradation of c- fos mRNA is an important mechanism for controlling c-fos expression. Rapid mRNA turnover mediated by the protein-coding-region determinant (mCRD) of the c-fos transcript illustrates a functional interplay between mRNA turnover and translation that coordinately influences the fate of cytoplasmic mRNA. It is suggested that mCRD communicates with the 3′ poly(A) tail via an mRNP complex comprising mCRD-associated proteins, which prevents deadenylation in the absence of translation. Ribosome transit as a result of translation is required to alter the conformation of the mRNP complex, thereby eliciting accelerated deadenylation and mRNA decay. To gain further insight into the mechanism of mCRD-mediated mRNA turnover, Unr was identified as an mCRD-binding protein, and its binding site within mCRD was characterized. Moreover, the functional role for Unr in mRNA decay was demonstrated. The result showed that elevation of Unr protein level in the cytoplasm led to inhibition of mRNA destabilization by mCRD. In addition, GST pull-down assay and immuno-precipitation analysis revealed that Unr interacted with PABP in an RNA-independent manner, which identified Unr as a novel PABP-interacting protein. Furthermore, the Unr interacting domain in PABP was characterized. In vivo mRNA decay experiments demonstrated a role for Unr-PABP interaction in mCRD-mediated mRNA decay. In conclusion, the findings of this study provide the first evidence that Unr plays a key role in mCRD-mediated mRNA decay. It is proposed that Unr is recruited by mCRD to initiate the formation of a dynamic mRNP complex for communicating with poly(A) tail through PABP. This unique mRNP complex may couple translation to mRNA decay, and perhaps to recruit the responsible nuclease for deadenylation. ^

(Table 11-I, page 338) Metal contents (%) of a representative sampling of manganese nodules from the North Pacific high-grade region

Two types of deep-sea dredges are currently under development for the mining of the manganese nodules, a deep-sea hydraulic dredge and a mechanical cable-bucket system. Both systems offer some advantages with the hydraulic system appearing to be advantageous in themining of a specific deposit for which it is designed while the cable-bucket system appears to be somewhat more flexible in working in a variety of deposits, topographic environments, and water depths. Environmental studies conducted in conjunction with deep-sea tests of the two types of mining systems currently indicate that substantially no environmental damage will be done in the mining of the deep-sea nodules. Because of the nature of the deposits and the way in which they can be mined, the manganese nodules appear to be a relatively pollution free and energy-saving source of a number of industrially important metals.

Daily polynya area and ice production in the North Water polynya region

The North Water (NOW) Polynya is a regularly-forming area of open-water and thin-ice, located between northwestern Greenland and Ellesmere Island (Canada) at the northern tip of Baffin Bay. Due to its large spatial extent, it is of high importance for a variety of physical and biological processes, especially in wintertime. Here, we present a long-term remote sensing study for the winter seasons 1978/1979 to 2014/2015. Polynya characteristics are inferred from (1) sea ice concentrations and brightness temperatures from passive microwave satellite sensors (Advanced Microwave Scanning Radiometer (AMSR-E and AMSR2), Scanning Multichannel Microwave Radiometer (SMMR), Special Sensor Microwave Imager/Sounder (SSM/I-SSMIS)) and (2) thin-ice thickness distributions, which are calculated using MODIS ice-surface temperatures and European Center for Medium-Range Weather Forecasts (ECMWF) atmospheric reanalysis data in a 1D thermodynamic energy-balance model. Daily ice production rates are retrieved for each winter season from 2002/2003 to 2014/2015, assuming that all heat loss at the ice surface is balanced by ice growth. Two different cloud-cover correction schemes are applied on daily polynya area and ice production values to account for cloud gaps in the MODIS composites. Our results indicate that the NOW polynya experienced significant seasonal changes over the last three decades considering the overall frequency of polynya occurrences, as well as their spatial extent. In the 1980s, there were prolonged periods of a more or less closed ice cover in northern Baffin Bay in winter. This changed towards an average opening on more than 85% of the days between November and March during the last decade. Noticeably, the sea ice cover in the NOW polynya region shows signs of a later-appearing fall freeze-up, starting in the late 1990s. Different methods to obtain daily polynya area using passive microwave AMSR-E/AMSR2 data and SSM/I-SSMIS data were applied. A comparison with MODIS data (thin-ice thickness < 20 cm) shows that the wintertime polynya area estimates derived by MODIS are about 30 to 40% higher than those derived using the polynya signature simulation method (PSSM) with AMSR-E data. In turn, the difference in polynya area between PSSM and a sea ice concentration (SIC) threshold of 70% is fairly low (approximately 10%) when applied to AMSR-E data. For the coarse-resolution SSM/I-SSMIS data, this difference is much larger, particularly in November and December. Instead of a sea ice concentration threshold, the PSSM method should be used for SSM/I-SSMIS data. Depending on the type of cloud-cover correction, the calculated ice production based on MODIS data reaches an average value of 264.4 ± 65.1 km**3 to 275.7 ± 67.4 km**3 (2002/2003 to 2014/2015) and shows a high interannual variability. Our achieved long-term results underline the major importance of the NOW polynya considering its influence on Arctic ice production and associated atmosphere/ocean processes.