993 resultados para Acylation-stimulating Protein


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The E6 protein of the high-risk human papillomaviruses inactivates the tumor suppressor protein p53 by stimulating its ubiquitinylation and subsequent degradation. Ubiquitinylation is a multistep process involving a ubiquitin-activating enzyme, one of many distinct ubiquitin-conjugating enzymes, and in certain cases, a ubiquitin ligase. In human papillomavirus-infected cells, E6 and the E6-associated protein are thought to act as a ubiquitin-protein ligase in the ubiquitinylation of p53. Here we describe the cloning of a human ubiquitin-conjugating enzyme that specifically ubiquitinylates E6-associated protein. Furthermore, we define the biochemical pathway of p53 ubiquitinylation and demonstrate that in vivo inhibition of various components in the pathway leads to an inhibition of E6-stimulated p53 degradation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

La vaccination est largement utilisée pour la génération de lymphocytes T spécifiques contre les tumeurs. Malheureusement, cette stratégie n'est pas adaptée aux personnes âgées car leur thymus régresse avec l'âge conduisant ainsi à une baisse dans la production de cellules T et à l'accumulation de cellules immunitaires âgées ayant des défauts liés à leurs stimulations. Comme il a été démontré auparavant que L’IL-21 est capable d’induire des fonctions thymiques, nous avons émis l’hypothèse que l’injection d’IL-21 à des souris âgées stimulera la thymopoïèse. Nos résultats montrent que l’administration de l’IL-21 augmente le nombre absolu de thymocytes chez les souris âgées et augmente la migration de ces cellules vers la périphérie ou ils contribuent à la diversité du TCR. De plus les cellules T en périphérie expriment un niveau plus élevé de miR181-a, et par conséquent moins de phosphatase comme SHP2, DUSP5/6 qui inhibent le TCR. En vaccinant des souris âgées avec le peptide Trp2, les souris traitées avec l’IL-21 montrent un retard dans la croissance des cellules B16 tumorales. Cette étude montre que l’IL-21 pourrait être utilisé comme stratégie pour le rétablissement du systeme immunitaire chez les personnes âgées.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Expression of the mouse transcription factor EC (Tfec) is restricted to the myeloid compartment, suggesting a function for Tfec in the development or function of these cells. However, mice lacking Tfec develop normally, indicating a redundant role for Tfec in myeloid cell development. We now report that Tfec is specifically induced in bone marrow-derived macrophages upon stimulation with the Th2 cytokines, IL-4 and IL-13, or LPS. LPS induced a rapid and transient up-regulation of Tfec mRNA expression and promoter activity, which was dependent on a functional NF-kappa B site. IL-4, however, induced a rapid, but long-lasting, increase in Tfec mRNA, which, in contrast to LPS stimulation, also resulted in detectable levels of Tfec protein. IL-4-induced transcription of Tfec was absent in macrophages lacking Stat6, and its promoter depended on two functional Stat6-binding sites. A global comparison of IL-4-induced genes in both wild-type and Tfec mutant macrophages revealed a surprisingly mild phenotype with only a few genes affected by Tfec deficiency. These included the G-CSFR (Csf3r) gene that was strongly up-regulated by IL-4 in wild-type macrophages and, to a lesser extent, in Tfec mutant macrophages. Our study also provides a general definition of the transcriptome in alternatively activated mouse macrophages and identifies a large number of novel genes characterizing this cell type.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Neutrophilic lung inflammation is an essential component of host defense against diverse eukaryotic and prokaryotic pathogens, but in chronic inflammatory lung diseases, such as chronic obstructive lung disease (COPD), severe asthma, cystic fibrosis, and bronchiolitis, it may damage the host. Glucocorticosteroids are widely used in these conditions and in their infectious exacerbations; however, the clinical efficacy of steroids is disputed. In this study, we used a proteomic approach to identify molecules contributing to neutrophilic inflammation induced by transnasal administration of lipopolysaccharide (LPS) that were also resistant to the potent glucocorticosteroid dexamethasone (Dex). We confirmed that Dex was biologically active at both the transcript (suppression of GM-CSF and TNFalpha transcripts) and protein levels (induction of lipocortin) and used 2D-PAGE/MALDI-TOF to generate global expression profiles, identifying six LPS-induced proteins that were Dex resistant. Of these, S100A8, a candidate neutrophil chemotactic factor, was profiled in detail. Steroid refractory S100A8 expression was highly abundant, transcriptionally regulated, secreted into lung lavage fluid and immunohistochemically localized to tissue infiltrating neutrophils. However, in marked contrast to other vascular beds, neutralizing antibodies to S100A8 had only a weak anti-neutrophil recruitment effect and antibodies against the related S100A9 were ineffective. These data highlight the need for extensive in vivo profiling of proteomically identified candidate molecules and demonstrates that S100A8, despite its abundance, resistance to steroids and known chemotactic activity, is unlikely to be an important determinant of LPS-induced neutrophilic lung inflammation in vivo.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To date, a role for agouti signalling protein (ASIP) in human pigmentation has not been well characterized. It is known that agouti plays a pivotal role in the pigment switch from the dark eumelanin to the light pheomelanin in the mouse. However, because humans do not have an agouti banded hair pattern, its role in human pigmentation has been questioned. We previously identified a single polymorphism in the 3'-untranslated region (UTR) of ASIP that was found at a higher frequency in African-Americans compared with other population groups. To compare allele frequencies between European-Australians and indigenous Australians, the g.8818A -> G polymorphism was genotyped. Significant differences were seen in allele frequencies between these groups (P < 0.0001) with carriage of the G allele highest in Australian Aborigines. In the Caucasian sample set a strong association was observed between the G allele and dark hair colour (P = 0.004) (odds ratio 4.6; 95% CI 1.4-15.27). The functional consequences of this polymorphism are not known but it was postulated that it might result in message instability and premature degradation of the transcript. To test this hypothesis, ASIP mRNA levels were quantified in melanocytes carrying the variant and non-variant alleles. Using quantitative real-time polymerase chain reaction the mean ASIP mRNA ratio of the AA genotype to the AG genotype was 12 (P < 0.05). This study suggests that the 3'-UTR polymorphism results in decreased levels of ASIP and therefore less pheomelanin production.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To determine if low dietary protein concentration in the first two trimesters of pregnancy alters placental development, genetically similar heifers from closed herd were fed diets containing different levels of protein in the first and second trimesters of gestation. There were four animals per treatment group, the groups being: L/L = fed a diet containing 7% crude protein (CP) (low protein) in the first and second trimesters; H/H = fed a diet containing 14% (P thigh protein) in the first and second trimesters; L/H = fed low protein in the first trimester and high in the second trimester and vice versa for the H/L group. Low protein diets in the first trimester increased dry cotyledon weight at term. Trophectoderm volume density increased in the H/L and L/H group compared to the L/L and H/H groups. Blood vessel volume and volume density in foetal villi decreased in the H/L and L/H groups compared with the H/H and L/L groups. There was no effect of diet treatment on cotyledon number, diameter or wet weight and no effect on the volume density of connective tissue or fibroblasts in the foetal villi. These results show that a low dietary protein concentration in the first trimester of pregnancy followed by increased protein in the second trimester enhanced placental development. Further, trophectoderm volume was highly correlated with birth weight. Early protein restriction in the pregnant cow may enhance foetal growth in part by stimulating placental growth and function. (C) 1999 Published by Elsevier Science B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aberrant tyrosine protein kinase activity has been implicated in the formation and maintenance of malignancy and so presents a potential target for cancer chemotherapy. Quercetin, a naturally occuring flavonoid, inhibits the tyrosine protein kinase encoded by the Rous sarcoma virus but also exhibits many other effects. Analogues of this compound were synthesised by the acylation of suitable 2-hydroxyacetophenones with appropriately substituted aromatic (or alicyclic) acid chlorides, followed by base catalysed rearrangement to the 1-(2-hydroxyphenyl)-3-phenylpropan-1,3-diones. Acid catalysed ring closure furnished flavones. The majority of the 1-(2-hydroxyphenyl)-3-phenylpropan-1,3-diones were shown by NMR to exist in the enol form. This was supported by the crystal structure of 1-(2-hydroxy-4-methoxyphenyl)-3-phenylpropan-1,3-dione. In contrast, 1.(4,6-dimethoxy-2-hydroxyphenyl)-3-phenylpropan-1,3-dione did not exhibit keto-enol tautomerism in the NMR spectrum and was shown in its crystal structure to assume a twisted conformation. Assessment of the biological activity of the analogues of quercetin was carried out using whole cells and the kinase domain of the tyrosine protein kinase encoded by the Abelson murine leukaemia virus, ptab150 kinase. Single cell suspension cultures and clonogenic potential of murine fibroblasts transformed by the Abelson Murine leukaemia virus (ANN-1 cells) did not indicate the existence of any structure activity relationship required for cytotoxicity or cytostasis. No selective toxicity was apparent when the `normal' parent cell line, (3T3), was used to assess the cytotoxic potential of quercetin. The ICS50 for these compounds were generally in the region of 1-100M. The potential for these compounds to inhibit ptab150 kinase was determined. A definite substitution requirement emerged from these experiments indicating a necessity for substituents in the A ring or in the 3-position of the flavone nucleus. Kinetic data showed these inhibitors to be competitive for ATP.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background and Purpose The glucagon-like peptide 1 (GLP-1) receptor performs an important role in glycaemic control, stimulating the release of insulin. It is an attractive target for treating type 2 diabetes. Recently, several reports of adverse side effects following prolonged use of GLP-1 receptor therapies have emerged: most likely due to an incomplete understanding of signalling complexities. Experimental Approach We describe the expression of the GLP-1 receptor in a panel of modified yeast strains that couple receptor activation to cell growth via single Gα/yeast chimeras. This assay enables the study of individual ligand-receptor G protein coupling preferences and the quantification of the effect of GLP-1 receptor ligands on G protein selectivity. Key Results The GLP-1 receptor functionally coupled to the chimeras representing the human Gαs, Gαi and Gαq subunits. Calculation of the dissociation constant for a receptor antagonist, exendin-3 revealed no significant difference between the two systems. We obtained previously unobserved differences in G protein signalling bias for clinically relevant therapeutic agents, liraglutide and exenatide; the latter displaying significant bias for the Gαi pathway. We extended the use of the system to investigate small-molecule allosteric compounds and the closely related glucagon receptor. Conclusions and Implications These results provide a better understanding of the molecular events involved in GLP-1 receptor pleiotropic signalling and establish the yeast platform as a robust tool to screen for more selective, efficacious compounds acting at this important class of receptors in the future. © 2014 The Authors. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of The British Pharmacological Society.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Calcium (Ca2+) is a known important second messenger. Calcium/Calmodulin (CaM) dependent protein kinase kinase 2 (CaMKK2) is a crucial kinase in the calcium signaling cascade. Activated by Ca2+/CaM, CaMKK2 can phosphorylate other CaM kinases and AMP-activated protein kinase (AMPK) to regulate cell differentiation, energy balance, metabolism and inflammation. Outside of the brain, CaMKK2 can only be detected in hematopoietic stem cells and progenitors, and in the subsets of mature myeloid cells. CaMKK2 has been noted to facilitate tumor cell proliferation in prostate cancer, breast cancer, and hepatic cancer. However, whethter CaMKK2 impacts the tumor microenvironment especially in hematopoietic malignancies remains unknown. Due to the relevance of myeloid cells in tumor growth, we hypothesized that CaMKK2 has a critical role in the tumor microenvironment, and tested this hyopothesis in murine models of hematological and solid cancer malignancies.

We found that CaMKK2 ablation in the host suppressed the growth of E.G7 murine lymphoma, Vk*Myc myeloma and E0771 mammary cancer. The selective ablation of CaMKK2 in myeloid cells was sufficient to restrain tumor growth, of which could be reversed by CD8 cell depletion. In the lymphoma microenvironment, ablating CaMKK2 generated less myeloid-derived suppressor cells (MDSCs) in vitro and in vivo. Mechanistically, CaMKK2 deficient dendritic cells showed higher Major Histocompatibility Class II (MHC II) and costimulatory factor expression, higher chemokine and IL-12 secretion when stimulated by LPS, and have higher potent in stimulating T-cell activation. AMPK, an anti-inflammatory kinase, was found as the relevant downstream target of CaMKK2 in dendritic cells. Treatment with CaMKK2 selective inhibitor STO-609 efficiently suppressed E.G7 and E0771 tumor growth, and reshaped the tumor microenvironment by attracting more immunogenic myeloid cells and infiltrated T cells.

In conclusion, we demonstrate that CaMKK2 expressed in myeloid cells is an important checkpoint in tumor microenvironment. Ablating CaMKK2 suppresses lymphoma growth by promoting myeloid cells development thereby decreasing MDSCs while enhancing the anti-tumor immune response. CaMKK2 inhibition is an innovative strategy for cancer therapy through reprogramming the tumor microenvironment.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: We report the use of an ex vivo precision cut liver slice (PCLS) mouse model for studying hepatic schistosomiasis. In this system, liver tissue is unfixed, unfrozen, and alive for maintenance in culture and subsequent molecular analysis.

METHODS AND FINDINGS: Using thick naive mouse liver tissue and sterile culture conditions, the addition of soluble egg antigen (SEA) derived from Schistosoma japonicum eggs, followed 4, 24 and 48 hrs time points. Tissue was collected for transcriptional analysis and supernatants collected to quantitate liver enzymes, cytokines and chemokines. No significant hepatotoxicity was demonstrated by supernatant liver enzymes due to the presence of SEA. A proinflammatory response was observed both at the transcriptional level and at the protein level by cytokine and chemokine bead assay. Key genes observed elevated transcription in response to the addition of SEA included: IL1-α and IL1-β, IL6, all associated with inflammation. The recruitment of antigen presenting cells was reflected in increases in transcription of CD40, CCL4 and CSF1. Indications of tissue remodeling were seen in elevated gene expression of various Matrix MetalloProteinases (MMP3, 9, 10, 13) and delayed increases in TIMP1. Collagen deposition was significantly reduced in the presence of SEA as shown in COL1A1 expression by qPCR after 24 hrs culture. Cytokine and chemokine analysis of the culture supernatants confirmed the elevation of proteins including IL6, CCL3, CCL4 and CXCL5.

CONCLUSIONS: This ex vivo model system for the synchronised delivery of parasite antigen to liver tissue provides an insight into the early phase of hepatic schistosomiasis, corresponding with the release of soluble proteins from dying schistosome eggs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fascioliasis (or fasciolosis) is a socioeconomically important parasitic disease caused by liver flukes of the genus Fasciola. Flukicide resistance has exposed the need for new drugs and/or a vaccine for liver fluke control. A rapidly improving 'molecular toolbox' for liver fluke encompasses quality genomic/transcriptomic datasets and an RNA interference platform that facilitates functional genomics approaches to drug/vaccine target validation. The exploitation of these resources is undermined by the absence of effective culture/maintenance systems that would support in vitro studies on juvenile fluke development/biology. Here we report markedly improved in vitro maintenance methods for Fasciola hepatica that achieved 65% survival of juvenile fluke after 6 months in standard cell culture medium supplemented with 50% chicken serum. We discovered that this long-term maintenance was dependent upon fluke growth, which was supported by increased proliferation of cells resembling the "neoblast" stem cells described in other flatworms. Growth led to dramatic morphological changes in juveniles, including the development of the digestive tract, reproductive organs and the tegument, towards more adult-like forms. The inhibition of DNA synthesis prevented neoblast-like cell proliferation and inhibited growth/development. Supporting our assertion that we have triggered the development of juveniles towards adult-like fluke, mass spectrometric analyses showed that growing fluke have an excretory/secretory protein profile that is distinct from that of newly-excysted juveniles and more closely resembles that of ex vivo immature and adult fluke. Further, in vitro maintained fluke displayed a transition in their movement from the probing behaviour associated with migrating stage worms to a slower wave-like motility seen in adults. Our ability to stimulate neoblast-like cell proliferation and growth in F. hepatica underpins the first simple platform for their long-term in vitro study, complementing the recent expansion in liver fluke resources and facilitating in vitro target validation studies of the developmental biology of liver fluke.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Infant formula is consumed by the majority of infants in the United States for at least part of the first year of life. Infant formula lacks many of the bioactive compounds that are naturally occurring in breast milk. Because of this, there has been an increased interest by the companies that manufacture infant formula to include additives that would potentially allow formula to more closely mimic breast milk activity. One such ingredient currently being added to infant formula is prebiotics. Prebiotics are non-digestible food ingredients that beneficially affect the host by selectively stimulating the growth of specific healthful bacteria in the colon. It is speculated that prebiotics replicate the activity of breast milk oligosaccharides, which through the production of butyrate by intestinal microbiota, may interact with the Wnt/BMP pathways. The Wnt/BMP pathways regulate intestinal stem cells, which determine the growth, development and maintenance of the intestine. Therefore, the objective of this study was to explore the effects that the addition of prebiotics to formula have on the regulation of the Wnt/BMP pathways when fed to neonatal piglets, a model commonly used in the study of infant nutrition. Piglets (n=5) were randomized into sow-reared (SR), fed control formula (F), or fed formula with added prebiotics (F+P). Fructooligosaccharides (FOS) (2 g/L) and polydextrose (PDX) (2 g/L) were chosen as the prebiotics for this study, because this combination had been less studied than other combinations. Ileum and ascending colon were collected at 7 and 14 days-of-age. Dry matter content, pH, and short chain fatty acid (SCFA) content was measured. The mRNA expression of β-catenin, sFRP3, sFRP4, frizzled 6, DKK1 (Wnt pathway), gremlin (BMP pathway), TNF-a, HNF-4α and osteopontin (OPN) was measured by RT-qPCR. Piglets fed the F+P diet had greater acetate concentration and lower pH in the ileum at day 14 and in the colon at day 7 and day 14 than F piglets. Butyrate concentrations were highest in SR with F+P not differing from F in ileum at day 14 and colon at day 7 and day 14. Effects of age were seen in all genes, with the exception of OPN, sFRP-3 and sFRP-4. On day 7, no effect of diet was observed in the ileum, however, mRNA expression of DKK1 and frizzled 6 were greater in F+P than SR (p≤0.05). On day 14, gremlin expression was lower and OPN was greater in the ileum of SR piglets compared to F and F+P. Also on day 14, HNF-4α mRNA expression was greater in both ileum and colon of F+P piglets and sFRP3 mRNA expression was greater in the colon than F or SR . In summary, differences were observed between gene expression of F+P and SR piglet intestines, but the supplementation of 2 g/L scFOS and 2 g/L PDX to formula did not shift expression of genes in the Wnt/BMP pathways to be more similar to SR than F. As the Wnt/BMP pathway is known to exist in a gradient along the crypt-villus axis, with Wnt expression dominating in the crypt region and BMP expression dominating in the villi, it was possible that pooling whole tissue reduced our ability to detect treatment effects that would be concentrated in either region. A method was therefore developed to remove intestinal epithelial cells along the villus-to-crypt axis. Twenty-five-day-old F and SR piglets were euthanized and ileal tissue was collected and placed in a dissociation buffer in a shaking water bath. Exfoliated cells were removed at increasing time points from 5 to 100 minutes in order to remove cells along the villus-to-crypt axis. After the final incubation, remaining mucosal tissue was removed using a sterile glass microscope slide and pooled with the final exfoliated cell isolation. After each cell collection, a section of tissue was fixed in formalin for histomorphological examination. Expression of genes in the Wnt/BMP pathways, along with crypt marker genes (CDK5 and v-myb), were measured in both whole ileal tissue, pooled epithelial cells, and separate epithelial cell isolations from the same piglet. The expression of β-catenin, HNF-4α, TNF-α, TGF-β and the crypt marker v-myb matched the expected villus-to-crypt pattern in cells collected after 10 (incubation 1), 30 (incubation 2) and 60 (incubation 3) minutes. However, expression of expression in cells collected after 100 minutes (incubation 4) was variable, which may be due to the fact that crypt cells were not efficiently removed and the presence of unwanted non-epithelial tissue. Gremlin, OPN, DKK1, sFRP3 and sFRP4 expression was not statistically different along the villus-to-crypt axis. Frizzled 6 and CDK5 did not express as we had predicted, with expression highest towards the villi. In summary, the epithelial cell collection method used was not entirely successful. While much of the gene data suggests that cells were removed along the villus-to-crypt axis through the first three incubations, the last incubation, which involved scraping the tissue, removed non-epithelial components of the mucosa, while leaving the crypts intact. In conclusion, the addition of 2 g/L PDX and 2 g/L scFOS did not cause gene expression of the Wnt/BMP pathways to mirror either F or SR expression. New isolation methods to extract cells along the crypt-villus axis should be considered, including the use of a laser capture microdissection. While this combination of prebiotics did not yield the intended effects, future research should be done on other combinations, such as the inclusion of galactooligosaccharides (GOS), which is commonly added to food products including infant formula.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pancreatic β-cells are highly sensitive to suboptimal or excess nutrients, as occurs in protein-malnutrition and obesity. Taurine (Tau) improves insulin secretion in response to nutrients and depolarizing agents. Here, we assessed the expression and function of Cav and KATP channels in islets from malnourished mice fed on a high-fat diet (HFD) and supplemented with Tau. Weaned mice received a normal (C) or a low-protein diet (R) for 6 weeks. Half of each group were fed a HFD for 8 weeks without (CH, RH) or with 5% Tau since weaning (CHT, RHT). Isolated islets from R mice showed lower insulin release with glucose and depolarizing stimuli. In CH islets, insulin secretion was increased and this was associated with enhanced KATP inhibition and Cav activity. RH islets secreted less insulin at high K(+) concentration and showed enhanced KATP activity. Tau supplementation normalized K(+)-induced secretion and enhanced glucose-induced Ca(2+) influx in RHT islets. R islets presented lower Ca(2+) influx in response to tolbutamide, and higher protein content and activity of the Kir6.2 subunit of the KATP. Tau increased the protein content of the α1.2 subunit of the Cav channels and the SNARE proteins SNAP-25 and Synt-1 in CHT islets, whereas in RHT, Kir6.2 and Synt-1 proteins were increased. In conclusion, impaired islet function in R islets is related to higher content and activity of the KATP channels. Tau treatment enhanced RHT islet secretory capacity by improving the protein expression and inhibition of the KATP channels and enhancing Synt-1 islet content.