963 resultados para ALPHA-GALACTOSIDASE GENE
Resumo:
Fabry disease is a lysosomal storage disorder (LSD) caused by a deficiency in alpha-galactosidase A. The disease is characterized by severe major organ involvement, but the pathologic mechanisms responsible have not been elucidated. Disruptions of autophagic processes have been reported for other LSDs, but have not yet been investigated in Fabry disease. Renal biopsies were obtained from five adult male Fabry disease patients before and after three years of enzyme replacement therapy (ERT) with agalsidase alfa. Vacuole accumulation was seen in renal biopsies from all patients compared with control biopsies. Decreases in the number of vacuoles were seen after three years of ERT primarily in renal endothelial cells and mesangial cells. Measurement of the levels of LC3, a specific autophagy marker, in cultured cells from Fabry patients revealed increased basal levels compared to cells from non-Fabry subjects and a larger increase in response to starvation than seen in non-Fabry cells. Starvation in the presence of protease inhibitors did not result in a significant increase in LC3 in Fabry cells, whereas a further increase in LC3 was observed in non-Fabry cells, an observation that is consistent with impaired autophagic flux in Fabry disease. Overexpression of LC3 mRNA in Fabry fibroblasts compared to control cells is consistent with an upregulation of autophagy. Furthermore, LC3 and p62/SQSTM1 (that binds to LC3) staining in renal tissues and in cultured fibroblasts from Fabry patients supports impairment of autophagic flux. These findings suggest that Fabry disease is linked to a deregulation of autophagy.
Resumo:
BACKGROUND: In Fabry nephropathy, alpha-galactosidase deficiency leads to accumulation of glycosphingolipids in all kidney cell types, proteinuria and progressive loss of kidney function. METHODS: An international working group of nephrologists from 11 Fabry centres identified adult Fabry patients, and pathologists scored histologic changes on renal biopsies. A standardized scoring system was developed with a modified Delphi technique assessing 59 Fabry nephropathy cases. Each case was scored independently of clinical information by at least three pathologists with an average final score reported. RESULTS: We assessed 35 males (mean age 36.4 years) and 24 females (43.9 years) who mostly had clinically mild Fabry nephropathy. The average serum creatinine was 1.3 mg/dl (114.9 micromol/l); estimated glomerular filtration rate was 81.7 ml/min/1.73 m(2) and urine protein to creatinine ratio was 1.08 g/g (122.0 mg/mmol). Males had greater podocyte vacuolization on light microscopy (mean score) and glycosphingolipid inclusions on semi-thin sections than females. Males also had significantly more proximal tubule, peritubular capillary and vascular intimal inclusions. Arteriolar hyalinosis was similar, but females had significantly more arterial hyalinosis. Chronic kidney disease stage correlated with arterial and glomerular sclerosis scores. Significant changes, including segmental and global sclerosis, and interstitial fibrosis were seen even in patients with stage 1-2 chronic kidney disease with minimal proteinuria. CONCLUSIONS: The development of a standardized scoring system of both disease-specific lesions, i.e. lipid deposition related, and general lesions of progression, i.e. fibrosis and sclerosis, showed a spectrum of histologic appearances even in early clinical stage of Fabry nephropathy. These findings support the role of kidney biopsy in the baseline evaluation of Fabry nephropathy, even with mild clinical disease. The scoring system will be useful for longitudinal assessment of prognosis and responses to therapy for Fabry nephropathy.
Resumo:
Fabry disease (FD) is an X-linked lysosomal storage disorder caused by deficiency of alpha-galactosidase A, which leads to storage of sphingolipids in virtually all human cells and consequently to organ dysfunction. Pulmonary involvement is still debated. But, obstructive lung disease is up to ten times more prevalent in patients with FD compared to general public. Also, an accelerated decline in forced expiratory volume in one second (FEV1) over time was observed in these patients. Lysosomal storage of glycosphingolipids is considered leading to small airway disease via hyperplasia of the bronchiolar smooth muscle cells. Larger airways may become involved with ongoing disease process. There is no evidence for involvement of the lung interstitium in FD. The effect of enzyme replacement therapy on respiratory involvement remains to be determined in large, prospective controlled trials.
Resumo:
Alcoholic liver disease is mediated via activation of TLR4 signaling; MyD88-dependent and -independent signals are important contributors to injury in mouse models. Adiponectin, an anti-inflammatory adipokine, suppresses TLR4/MyD88-dependent responses via induction of heme oxygenase-1 (HO-1). Here we investigated the interactions between chronic ethanol, adiponectin, and HO-1 in regulation of TLR4/MyD88-independent signaling in macrophages and an in vivo mouse model. After chronic ethanol feeding, LPS-stimulated expression of IFN-β and CXCL10 mRNA was increased in primary cultures of Kupffer cells compared with pair-fed control mice. Treatment of Kupffer cells with globular adiponectin (gAcrp) normalized this response. LPS-stimulated IFN-β/CXCL10 mRNA and CXCL10 protein was also reduced in RAW 264.7 macrophages treated with gAcrp or full-length adiponectin. gAcrp and full-length adiponectin acted via adiponectin receptors 1 and 2, respectively. gAcrp decreased TLR4 expression in both Kupffer cells and RAW 264.7 macrophages. Small interfering RNA knockdown of HO-1 or inhibition of HO-1 activity with zinc protoporphyrin blocked these effects of gAcrp. C57BL/6 mice were exposed to chronic ethanol feeding, with or without treatment with cobalt protoporphyrin, to induce HO-1. After chronic ethanol feeding, mice were sensitized to in vivo challenge with LPS, expressing increased IFN-β/CXCL10 mRNA and CXCL10 protein in liver compared with control mice. Pretreatment with cobalt protoporphyrin 24 h before LPS challenge normalized this effect of ethanol. Adiponectin and induction of HO-1 potently suppressed TLR4-dependent/MyD88-independent cytokine expression in primary Kupffer cells from rats and in mouse liver after chronic ethanol exposure. These data suggest that induction of HO-1 may be a useful therapeutic strategy in alcoholic liver disease.
Resumo:
A limited number of receptor tyrosine kinases (e.g., ErbB and fibroblast growth factor receptor families) have been genetically linked to breast cancer development. Here, we investigated the contribution of the Ret receptor tyrosine kinase to breast tumor biology. Ret was expressed in primary breast tumors and cell lines. In estrogen receptor (ER)alpha-positive MCF7 and T47D lines, the ligand (glial-derived neurotrophic factor) activated signaling pathways and increased anchorage-independent proliferation in a Ret-dependent manner, showing that Ret signaling is functional in breast tumor cells. Ret expression was induced by estrogens and Ret signaling enhanced estrogen-driven proliferation, highlighting the functional interaction of Ret and ER pathways. Furthermore, Ret was detected in primary cancers, and there were higher Ret levels in ERalpha-positive tumors. In summary, we showed that Ret is a novel proliferative pathway interacting with ER signaling in vitro. Expression of Ret in primary breast tumors suggests that Ret might be a novel therapeutic target in breast cancer.
Resumo:
In this study, we epidemiologically investigated on clinical isolates of Arthroderma benhamiae from humans and animals in Japan by internal transcribed spacer (ITS) region sequence analysis and mating type (MAT)-specific PCR. Seven of 8 A. benhamiae isolates from a human, rabbits and guinea pigs were identified as group I (white phenotype) by morphological characters and ITS region sequence analysis. One strain isolated from a degus (Octodon degus) produced colonies with few irregular folds and yellow velvety mycelium without macro- and microconidia. This strain resembled to group II (yellow phenotype) strain. ITS sequence analysis was also 100 % identical to that of group II. MAT-specific PCR indicated that 6 of these 7 isolates of group I contained an alpha-box gene and that one strain contained high-mobility-group (HMG) gene. One strain of group II was revealed to have an alpha-box gene and no HMG gene. To our knowledge, it is the first A. benhamiae isolate of group II found in Japan. The A. benhamiae may be more widespread in worldwide than our surpassing what is common or usual or expected.
Resumo:
Galactomannans (GM) are storage cell wall polysaccharides present in endospermic seeds of legumes. They are thought to be storage polymers, since it has been observed for a few species (among them Sesbania virgata) that they are completely broken down after germination and their products are transferred to the growing embryo. We examined the effect of 10-4 M abscisic acid (ABA) on the degradation of galactomannan in isolated endosperms and intact seeds of S. virgata. We found that after seed germination the initial embryo growth was retarded. Ultrastructural analysis showed that the embryo is completely surrounded by an endosperm which displays very thick galactomannan-containing cell walls. Although an inhibitory effect has been observed on the increase of fresh mass of the embryo, the effect of ABA on the dry mass was weaker and transitory (from 48 to 96 h). Endosperm dry mass and galactomannan degradation were significantly inhibited and the activity of alpha-galactosidase was strongly affected. The addition of ABA before and/or after the start of mobilisation in intact seeds or isolated endosperms, showed that whereas addition before mobilisation did not affect dry mass decrease in intact seeds, it was strongly affected in isolated endosperms. On the other hand, whereas it affected embryo fresh mass increase in intact seeds, but not in isolated embryos, no significant effect was observed on dry mass. These results suggest that ABA affects galactomannan degradation and by doing so, prevents water absorption by the embryo, rather than affect its dry mass. As ABA has been detected in the endosperm of seeds of S. virgata, it is proposed that it probably acts as a modulator of galactomannan mobilisation and consequently synchronises it with early growth of the embryo.
Resumo:
We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A) mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa). The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.
Resumo:
Fabry disease is an X-linked lysosomal disorder due to a-galactosidase A deficiency that causes storage of globotriaosylceramide. The gene coding for this lysosomal enzyme is located on the long arm of the X chromosome, in region Xq21.33-Xq22. Disease progression leads to vascular disease secondary to involvement of kidney, heart and the central nervous system. Detection of female carriers based solely on enzyme assays is often inconclusive. Therefore, mutation analysis is a valuable tool for diagnosis and genetic counseling. Many mutations of the a-galactosidase A gene have been reported with high genetic heterogeneity, being most mutations private found in only one family. The disease is panethnic, and estimates of incidence range from about 1 in 40,000 to 60,000 males. Our objective was to describe the analysis of 6 male and 7 female individuals belonging to 4 different Fabry disease families by automated sequencing of the seven exons of the a-galactosidase gene. Sequencing was performed using PCR fragments for each exon amplified from DNA extracted from peripheral blood. Three known mutations and one previously described in another Brazilian family were detected. Of 7 female relatives studied, 4 were carriers. Although the present study confirms the heterogeneity of mutations in Fabry disease, the finding of the same mutation previously detected in another Fabry family from our region raises the possibility of some founder effect, or genetic drift. Finally, the present study highlights the importance of molecular analysis for carrier detection and genetic counseling.
Resumo:
Endospermic legumes are abundant in tropical forests and their establishment is closely related to the mobilization of cell-wall storage polysaccharides. Endosperm cells also store large numbers of protein bodies that play an important role as a nitrogen reserve in this seed. In this work, a systems approach was adopted to evaluate some of the changes in carbohydrates and hormones during the development of seedlings of the rain forest tree Sesbania virgata during the period of establishment. Seeds imbibed abscisic acid (ABA), glucose and sucrose in an atmosphere of ethylene, and the effects of these compounds on the protein contents, alpha-galactosidase activity and endogenous production of ABA and ethylene by the seeds were observed. The presence of exogenous ABA retarded the degradation of storage protein in the endosperm and decreased alpha-galactosidase activity in the same tissue during galactomannan degradation, suggesting that ABA represses enzyme action. On the other hand, exogenous ethylene increased alpha-galactosidase activity in both the endosperm and testa during galactomannan degradation, suggesting an inducing effect of this hormone on the hydrolytic enzymes. Furthermore, the detection of endogenous ABA and ethylene production during the period of storage mobilization and the changes observed in the production of these endogenous hormones in the presence of glucose and sucrose, suggested a correlation between the signalling pathway of these hormones and the sugars. These findings suggest that ABA, ethylene and sugars play a role in the control of the hydrolytic enzyme activities in seeds of S. virgata, controlling the process of storage degradation. This is thought to ensure a balanced flow of the carbon and nitrogen for seedling development.
Resumo:
The endosperm of seeds of Sesbania virgata (Cav.) Pers. accumulates galactomannan as a cell wall storage polysaccharide. It is hydrolysed by three enzymes, one of them being alpha-galactosidase. A great amount of protein bodies is found in the cytoplasm of endospermic cells, which are thought to play the major role as a nitrogen reserve in this seed. The present work aimed at understanding how the production of enzymes that degrade storage compounds is controlled. We performed experiments with addition of inhibitors of transcription (actinomycin-d and alpha-amanitin) and translation (cycloheximide) during and after germination. In order to follow the performance of storage mobilisation, we measured fresh mass, protein contents and alpha-galactosidase activity. All the inhibitors tested had little effect on seed germination and seedling development. Actinomycin-d and cycloheximide provoked a slight inhibition of the storage protein degradation and concomitantly lead to an elevation of the alpha-galactosidase activity. Although alpha-amanitin showed some effect on seedling development at latter stages, it presented the former effect and did not change galactomannan degradation performance. Our data suggest that some of the proteases may be synthesised de novo, whereas alpha-galactosidase seems to be present in the endosperm cells probably as an inactive polypeptide in the protein bodies, being probably activated by proteolysis when the latter organelle is disassembled. These evidences suggest the existence of a connection between storage proteins and carbohydrates mobilisation in seeds of S. virgata, which would play a role by assuring a balanced afflux of the carbon and nitrogen to the seedling development.
Resumo:
Gibberella moniliformis is most commonly associated with maize worldwide and produces high levels of fumonisins, some of the most agriculturally important mycotoxins. Studies demonstrate that molecular methods can be helpful for a rapid identification of Fusarium species and their levels of toxin production. The purpose of this research was to apply molecular methods (AFLP, TEF-1 alpha partial gene sequencing and PCR based on MAT alleles) for the identification of Fusarium species isolated from Brazilian corn and to verify if real time RT-PCR technique based on FUM1 and FUM19 genes is appropriated to estimate fumonisins B(1) and B(2) production levels. Among the isolated strains, 96 were identified as Fusarium verricillioides, and four as other Fusarium species. Concordant phylogenies were obtained by AFLP and TEF-1 alpha sequencing, permitting the classification of the different species into distinct clades. Concerning MAT alleles, 70% of the F. verricillioides isolates carried the MAT-1 and 30% MAT-2. A significant correlation was observed between the expression of the genes and toxin production r=0.95 and r=0.79 (correlation of FUM1 with FB(1) and FB(2), respectively, P < 0.0001): r=0.93 and r =0.78 (correlation of FUM19 with FB(1) and FB(2). respectively, P < 0.0001). Molecular methods used in this study were found to be useful for the rapid identification of Fusarium species. The high and significant correlation between FUM1 and FUM19 expression and fumonisins production suggests that real time RT-PCR is suitable for studies considering the influence of abiotic and biotic factors on expression of these genes. This is the first report concerning the expression of fumonisin biosynthetic genes in Fusarium strains isolated from Brazilian agricultural commodity. (c) 2010 Elsevier B.V. All rights reserved.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
While many members of the black yeasts genus Cladophialophora have been reported to cause diseases in humans, understanding of their natural niche is frequently lacking. Some species can be recovered from the natural environment by means of selective isolation techniques. The present study focuses on a Cladophialophora strain that caused an interdigital tinea nigra-like lesion in a HIV-positive Brazilian child. The fungal infection was successfully treated with oxiconazole. Similar strains had been recovered from the environment in Brazil, Uruguay and the Netherlands. The strains were characterized by sequencing the Internal Transcribed Spacer (ITS) regions and the small subunit (SSU) of the nuclear ribosomal RNA gene, as well as the elongation factor 1-alpha (EF1) gene. Since no match with any known species was found, it is described as the new species, Cladophialophora saturnica.