The development of a real-time PCR to detect pathogenic Leptospira species in kidney tissue

A LightCycler(R) real-time PCR hybridization probe-based assay that detects a conserved region of the 16S rRNA gene of pathogenic but not saprophytic Leptospira species was developed for the rapid detection of pathogenic leptospires directly from processed tissue samples. In addition, a differential PCR specific for saprophytic leptospires and a control PCR targeting the porcine beta-actin gene were developed. To assess the suitability of these PCR methods for diagnosis, a trial was performed on kidneys taken from adult pigs with evidence of leptospiral infection, primarily a history of reproductive disease and serological evidence of exposure to pathogenic leptospires (n = 180) and aborted pig foetuses (n = 24). Leptospire DNA was detected by the 'pathogenic' specific PCR in 25 tissues (14%) and the control beta-actin PCR was positive in all 204 samples confirming DNA was extracted from all samples. No leptospires were isolated from these samples by culture and no positives were detected with the 'saprophytic' PCR. In a subsidiary experiment, the 'pathogenic' PCR was used to analyse kidney samples from rodents (n = 7) collected as part of vermin control in a zoo, with show animals with high microagglutination titres to Leptospira species, and five were positive. Fifteen PCR amplicons from 1 mouse, 2 rat and 14 pig kidney samples, were selected at random from positive PCRs (n = 30) and sequenced. Sequence data indicated L. interrogans DNA in the pig and rat samples and L. inadai DNA, which is considered of intermediate pathogenicity, in the mouse sample. The only successful culture was from this mouse kidney and the isolate was confirmed to be L. inadai by classical serology. These data suggest this suite of PCRs is suitable for testing for the presence of pathogenic leptospires in pig herds where abortions and infertility occur and potentially in other animals such as rodents. Crown Copyright (C) 2007 Published by Elsevier Ltd. All rights reserved.

Effects of long-term diabetes on the structure and cell proliferation of the myometrium in the early pregnancy of mice

P>It is known that the development of diabetic complications in human pregnancy is directly related to the severity and the duration of this pathology. In this study, we developed a model of long-term type 1 diabetes to investigate its effects on the cytoarchitecture, extracellular matrix and cell proliferation during the first adaptation phase of the myometrium for pregnancy. A single dose of alloxan was used to induce diabetes in mice prior to pregnancy. To identify the temporal effects of diabetes the mice were divided into two groups: Group D1 (females that became pregnant 90-100 days after alloxan); Group D2 (females that became pregnant 100-110 days after alloxan). Uterine samples were collected after 168 h of pregnancy and processed for light and electron microscopy. In both groups the histomorphometric evaluation showed that diabetes promoted narrowing of the myometrial muscle layers which was correlated with decreased cell proliferation demonstrated by PCNA immunodetection. In D1, diabetes increased the distance between muscle layers and promoted oedema. Contrarily, in D2 the distance between muscle layers decreased and, instead of oedema, there was a markedly deposition of collagen in the myometrium. Ultrastructural analysis showed that diabetes affects the organization of the smooth muscle cells and their myofilaments. Consistently, the immunoreaction for smooth muscle alpha-actin revealed clear disorganization of the contractile apparatus in both diabetic groups. In conclusion, the present model demonstrated that long-term diabetes promotes significant alterations in the myometrium in a time-sensitive manner. Together, these alterations indicate that diabetes impairs the first phenotypic adaptation phase of the pregnant myometrium.

Role of a Novel Tetrodotoxin-Resistant Sodium Channel in the Nitrergic Relaxation of Corpus Cavernosum from the South American Rattlesnake Crotalus Durissus Terrificus

Introduction. Coitus in snakes may last up to 28 hours; however, the mechanisms involved are unknown. Aim. To evaluate the relevance of the nitric oxide (NO)-cyclic guanosine monophosphate (cGMP)-phosphodiesterase type 5 (PDE5) system in snake corpus cavernosum reactivity. Methods. Hemipenes were removed from anesthetized South American rattlesnakes (Crotalus durissus terrificus) and studied by light and scanning electronic microscopy. Isolated Crotalus corpora cavernosa (CCC) were dissected from the non-spiny region of the hemipenises, and tissue reactivity was assessed in organ baths. Main Outcome Measures. Cumulative concentration-response curves were constructed for acetylcholine (ACh), sodium nitroprusside (SNP), 5-cyclopropyl-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]pyrimidin-4-ylamine (BAY 41-2272), and tadalafil in CCC precontracted with phenylephrine. Relaxation induced by electrical field stimulation (EFS) was also done in the absence and presence of N omega nitro-L-arginine methyl ester (L-NAME; 100 mu M), 1H-[1, 2, 4] oxadiazolo[4,3-a]quinoxalin-1-one (ODQ; 10 mu M) and tetrodotoxin (TTX; 1 mu M). Results. The hemipenes consisted of two functionally concentric corpora cavernosa, one of them containing radiating bundles of smooth muscle fibers (confirmed by alpha-actin immunostaining). Endothelial and neural nitric oxide synthases were present in the endothelium and neural structures, respectively; whereas soluble guanylate cyclase and PDE5 were expressed in trabecular smooth muscle. ACh and SNP relaxed isolated CCC, with the relaxations being markedly reduced by L-NAME and ODQ, respectively. BAY 41-2272 and tadalafil caused sustained relaxations with potency (pEC(50)) values of 5.84 +/- 0.17 and 5.10 +/- 0.08 (N = 3-4), respectively. In precontracted CCC, EFS caused frequency-dependent relaxations that lasted three times longer than those in mammalian CC. Although these relaxations were almost abolished by either L-NAME or ODQ, they were unaffected by TTX. In contrast, EFS-induced relaxations in marmoset CC were abolished by TTX. Conclusions. Rattlesnake CC relaxation is mediated by the NO-cGMP-PDE5 pathway in a manner similar to mammals. The novel TTX-resistant Na channel identified here may be responsible for the slow response of smooth muscle following nerve stimulation and could explain the extraordinary duration of snake coitus. Capel RO, Monica FZ, Porto M, Barillas S, Muscara MN, Teixeira SA, Arruda AMM, Pissinatti, L, Pissinatti A, Schenka AA, Antunes E, Nahoum C, Cogo JC, de Oliveira MA, and De Nucci G. Role of a novel tetrodotoxin-resistant sodium channel in the nitrergic relaxation of corpus cavernosum from the South American rattlesnake Crotalus durissus terrificus. J Sex Med 2011;8:1616-1625.

The Autoimmune Regulator (AIRE), Which Is Defective in Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Patients, Is Expressed in Human Epidermal and Follicular Keratinocytes and Associates With the Intermediate Filament Protein Cytokeratin 17

Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome, which is caused by mutation of the autoimmune regulator (AIRE) gene, is a highly variable disease characterized by multiple endocrine failure, chronic mucocutaneous candidiasis, and various ectodermal defects. AIRE is a transcriptional regulator classically expressed in medullary thymic epithelial cells, monocytes, macrophages, and dendritic cells. Previous studies have suggested that AIRE can shuttle between the nucleus and cytoplasm of cells, although its cytoplasmic functions are poorly characterized. Through mass spectrometry analysis of proteins co-immunoprecipitating with cytoplasmic AIRE, we identified a novel association of AIRE with the intermediate filament protein cytokeratin 17 (K17) in the THP-1 monocyte cell line. We confirmed AIRE expression in HaCaT epidermal keratinocytes, as well as its interaction with K17. Confocal microscopy of human fetal and adult scalp hair follicles demonstrated a cytoplasmic pattern of AIRE staining that moderately colocalized with K17. The cytoplasmic association of AIRE with the intermediate filament network in human epidermal and follicular keratinocytes may provide a new path to understanding the ectodermal abnormalities associated with the APECED syndrome. (Am J Pathol 2011, 178:983-988; DOI: 10.1016/j.ajpath.2010.12.007)

Molecular characterization and fumonisin production by Fusarium verticillioides isolated from corn grains of different geographic origins in Brazil

Gibberella moniliformis is most commonly associated with maize worldwide and produces high levels of fumonisins, some of the most agriculturally important mycotoxins. Studies demonstrate that molecular methods can be helpful for a rapid identification of Fusarium species and their levels of toxin production. The purpose of this research was to apply molecular methods (AFLP, TEF-1 alpha partial gene sequencing and PCR based on MAT alleles) for the identification of Fusarium species isolated from Brazilian corn and to verify if real time RT-PCR technique based on FUM1 and FUM19 genes is appropriated to estimate fumonisins B(1) and B(2) production levels. Among the isolated strains, 96 were identified as Fusarium verricillioides, and four as other Fusarium species. Concordant phylogenies were obtained by AFLP and TEF-1 alpha sequencing, permitting the classification of the different species into distinct clades. Concerning MAT alleles, 70% of the F. verricillioides isolates carried the MAT-1 and 30% MAT-2. A significant correlation was observed between the expression of the genes and toxin production r=0.95 and r=0.79 (correlation of FUM1 with FB(1) and FB(2), respectively, P < 0.0001): r=0.93 and r =0.78 (correlation of FUM19 with FB(1) and FB(2). respectively, P < 0.0001). Molecular methods used in this study were found to be useful for the rapid identification of Fusarium species. The high and significant correlation between FUM1 and FUM19 expression and fumonisins production suggests that real time RT-PCR is suitable for studies considering the influence of abiotic and biotic factors on expression of these genes. This is the first report concerning the expression of fumonisin biosynthetic genes in Fusarium strains isolated from Brazilian agricultural commodity. (c) 2010 Elsevier B.V. All rights reserved.

Angiotensin type 1 receptor mediates thyroid hormone-induced cardiomyocyte hypertrophy through the Akt/GSK-3 beta/mTOR signaling pathway

Several studies have implicated the renin angiotensin system in the cardiac hypertrophy induced by thyroid hormone. However, whether Angiotensin type 1 receptor (AT(1)R) is critically required to the development of T(3)-induced cardiomyocyte hypertrophy as well as whether the intracellular mechanisms that are triggered by AT(1)R are able to contribute to this hypertrophy model is unknown. To address these questions, we employed a selective small interfering RNA (siRNA, 50 nM) or an AT(1)R blocker (Losartan, 1 mu M) to evaluate the specific role of this receptor in primary cultures of neonatal cardiomyocytes submitted to T(3) (10 nM) treatment. The cardiomyocytes transfected with the AT(1)R siRNA presented reduced mRNA (90%, P < 0.001) and protein (70%, P < 0.001) expression of AT(1)R. The AT(1)R silencing and the AT(1)R blockade totally prevented the T(3)-induced cardiomyocyte hypertrophy, as evidenced by lower mRNA expression of atrial natriuretic factor (66%, P < 0.01) and skeletal alpha-actin (170%, P < 0.01) as well as by reduction in protein synthesis (85%, P < 0.001). The cardiomyocytes treated with T(3) demonstrated a rapid activation of Akt/GSK-3 beta/mTOR signaling pathway, which was completely inhibited by the use of PI3K inhibitors (LY294002, 10 mu M and Wortmannin, 200 nM). In addition, we demonstrated that the AT(1)R mediated the T(3)-induced activation of Akt/GSK-3 beta/mTOR signaling pathway, since the AT(1)R silencing and the AT(1)R blockade attenuated or totally prevented the activation of this signaling pathway. We also reported that local Angiotensin I/II (Ang I/II) levels (120%, P < 0.05) and the AT(1)R expression (180%, P < 0.05) were rapidly increased by T(3) treatment. These data demonstrate for the first time that the AT(1)R is a critical mediator to the T(3)-induced cardiomyocyte hypertrophy as well as to the activation of Akt/GSK-3 beta/mTOR signaling pathway. These results represent a new insight into the mechanism of T(3)-induced cardiomyocyte hypertrophy, indicating that the Ang I/II-AT(1)R-Akt/GSK-3 beta/mTOR pathway corresponds to a potential mediator of the trophic effect exerted by T(3) in cardiomyocytes.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Ocorrência e caracterização molecular de Cryptosporidium em cordeiros

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Molecular characterization of Cryptosporidium spp. from fecal samples of birds kept in captivity in Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Orchidopexy restores morphometric-stereologic changes in the caput epididymis and daily sperm production in cryptorchidic mice, although sperm transit time and fertility parameters remain impaired

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Cladophialophora saturnica sp nov., a new opportunistic species of Chaetothyriales revealed using molecular data

While many members of the black yeasts genus Cladophialophora have been reported to cause diseases in humans, understanding of their natural niche is frequently lacking. Some species can be recovered from the natural environment by means of selective isolation techniques. The present study focuses on a Cladophialophora strain that caused an interdigital tinea nigra-like lesion in a HIV-positive Brazilian child. The fungal infection was successfully treated with oxiconazole. Similar strains had been recovered from the environment in Brazil, Uruguay and the Netherlands. The strains were characterized by sequencing the Internal Transcribed Spacer (ITS) regions and the small subunit (SSU) of the nuclear ribosomal RNA gene, as well as the elongation factor 1-alpha (EF1) gene. Since no match with any known species was found, it is described as the new species, Cladophialophora saturnica.

Subcellular localization of proteins labeled with GFP in Xanthomonas citri ssp citri: targeting the division septum

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Exposure to ethinylestradiol during prenatal development and postnatal supplementation with testosterone causes morphophysiological alterations in the prostate of male and female adult gerbils

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Anatomy of smooth muscle cells in nonmalignant and malignant human prostate tissue

Differently graded areas of human prostate adenocarcinoma were examined after Masson's trichrome staining or immunohistochemistry for smooth muscle alpha-actin, type IV collagen and laminin. In addition, the ultrastructure of the prostatic smooth muscle cells (SMC) during glandular proliferation and epithelial invasion in selected tumors was studied. The SMC formed a thick layer below the epithelial structures in unaffected areas and were closely associated with each other in homotypic interactions. As the tumor grade increased, the SMC gradually lost interactions with each other and became atrophic. With the growth of the epithelial compartment, the SMC initially segregated to the tumor periphery and the intercellular spaces increased. In high grade tumors, the epithelial cancer cells invaded the spaces between the SMC. Immunohistochemical analysis of the basal membrane revealed increased disruption of the usually thick basal membrane, which became thinner and faintly stained with each of the antibodies used. We conclude that most SMC become atrophic following epithelial invasion in human tumors and that degradation of the basal membrane is an important factor in this process. At the ultrastructural level, different SMC phenotypes occur in prostatic tissues during epithelial invasion. Interconversion between these phenotypes is suggested and a probable relationship among them is proposed.

High fat-induced obesity associated with insulin-resistance increases FGF-2 content and causes stromal hyperplasia in rat ventral prostate

Obesity affects sex hormone secretion, which can negatively influence prostatic structure, homeostasis, and disease. This investigation aimed to evaluate the repercussions of obesity induced by a high-fat diet on the rat prostate, with or without treatment with the aromatase inhibitor, Letrozole. Adult Wistar rats were fed a high-fat diet (20% saturated fat, O) for 15 weeks to induce obesity or received a balanced diet (4% fat, C). Then, a group of C and O rats were daily treated with Letrozole (1 mg/kg b.w. per day) for 2 weeks (CL and OL, respectively). Subsequently, ventral prostate was processed for analysis by transmission electron microscopy, immunohistochemistry, and Western blotting. Obesity decreased 70% of the testosterone plasma level. The prostate showed epithelial atrophy and dilated acini in the intermediate portion and epithelial wrinkling in the distal tips. The relative frequency of smooth muscle alpha-actin in the O group increased by 67%. Ultrastructurally, epithelial cells in obese animals presented altered secretory organelles, lipid droplets, and thicker subjacent fibromuscular layer. Letrozole treatment caused a partial restoration of the prostatic changes caused by obesity. Obesity increased the prostatic content of fibroblast growth factor-2 (FGF-2) by 150%, and Letrozole treatment increased this protein even more in the control and obese groups. This investigation shows that obesity provokes structural and ultrastructural changes in the epithelium of rat prostate; these changes might affect gland homeostasis and physiology. The epithelial and smooth muscle cell hyperplasia and increased FGF-2 expression observed in this experimental model of obesity/insulin-resistance might explain the high frequency of benign prostatic hyperplasia in insulin-resistant men.