Resistant starch in cassava products

Found in different foods, starch is the most important source of carbohydrates in the diet. Some factors present in starchy foods influence the rate at which the starch is hydrolyzed and absorbed in vivo. Due the importance of cassava products in Brazilian diet, the objective of this study was to analyze total starch, resistant starch, and digestible starch contents in commercial cassava products. Thirty three commercial cassava products from different brands, classifications, and origin were analyzed. The method used for determination of resistant starch consisted of an enzymatic process to calculate the final content of resistant starch considering the concentration of glucose released and analyzed. The results showed significant differences between the products. Among the flours and seasoned flours analyzed, the highest levels of resistant starch were observed in the flour from Bahia state (2.21%) and the seasoned flour from Paraná state (1.93%). Starch, tapioca, and sago showed levels of resistant starch ranging from 0.56 to 1.1%. The cassava products analyzed can be considered good sources of resistant starch; which make them beneficial products to the gastrointestinal tract.

Characterization of blueberry fruits (Vaccinium spp.) and derived products

The objectives of this study were to physicochemically characterize and determine the antioxidant activities and anthocyanin contents of organic Rabbiteye blueberries grown in Southern Brazil and its derived products, in order to investigate the utility of food processing wastes as raw materials for developing products with beneficial health properties. The antioxidant capacity of the blueberries was superior to that of other fruits and juices. The pomace exhibited high activity, albeit lower than that of the fruit, while the flour and the dried blueberries lost 66% and 46% of the original antioxidant activity, respectively. The average anthocyanin contents of the fruits were moderate compared to other sources and species of blueberries. The pomace contains a large amount of anthocyanins while the flour and dried blueberries exhibited a 32% and 42% loss in anthocyanin content, respectively. The use of agro-industrial residues, in addition to adding value and minimizing the impact caused by the accumulation in the environment, can be directed toward the development of new products with bioactive properties.

Development of prebiotic food products and health benefits

In the current context from the nutritional and epidemiological point of view, it can be seen an occurrence increase of Chronic Non-Communicable Diseases, as well as the inflammatory ones, ordinarily associated to a wrong feed, poor in fibers and rich in fats and simple and refined carbohydrates. This view has evidenced a progressive increase of diseases, highlighting the importance of colonic microbiota as an active mechanism of infectious processes control and modulation of immunologic answer. Therefore, constant the worries related to recovering and maintenance of healthy intestines, stocked with prebiotic nutrients that support the survival of beneficial health agents. This way, researchers and the segment of food industry has encouraged the development of products with prebiotic properties, looking for the health promotion, treatment and diseases prevention, besides the strengthening on the competitive market. This article will embrace the contents about physiologic effects of the main known prebiotic, their potential in relation to fermentatives bacterias, new developed products and used methodologies to the recognition of pre and probiotic functions.

Production of phycobiliproteins by Arthrospira platensis under different lightconditions for application in food products

There has been an increase in investment in research on new sources of natural pigments for food application. Some cyanobacteria can change the structures responsible for light harvesting and cellular processes according to the wavelength and light intensity. This phenomenon has been described as complementary chromatic adaptation. The present study aimed to investigate the growth of Arthrospira platensis using different light qualities, irradiance, and wavelength by evaluating the production of biomass, proteins, and phycobiliproteins. The occurrence of the chromatic adaptation phenomenon in this cyanobacterium was also investigated. The microorganism used in this study, A. platensis, was grown in a Zarrouk medium under three irradiance levels, 50, 100, and 150 μmol fotons.m–2.s–1 with illumination provided by white and green fluorescent lamps. The condition of 150 µmol fotons.m–2.s–1 white light was the one that promoted the highest biomass production of A. platensis cultures (2115.24 mg.L–1). There was no difference in the production of total protein and total phycobiliproteins under the studied conditions. It is likely that the large supply of nitrogen in the Zarrouk medium was sufficient for cell growth and maintenance, and it supplied the production of accessory pigments composed of protein. Finally, there was no evidence of the complementary chromatic adaptation phenomenon in A. platensis cultivated under green light. Moreover, this condition did not increase phycocyanin production.

Characterization and nutritional value of precooked products of kiwicha grains (Amaranthus caudatus)

AbstractKiwicha has significant nutritional characteristics. It is commonly used as a puffed product, but there is little research on the lamination process. In this paper, the physical, functional properties, chemical composition and acceptability of the precooked kiwicha grains were studied. Puffed (PK) and laminated kiwicha (LK) were made. Puffed amaranth (CPA) was used as a commercial reference standard. The raw grain (RG) showed a higher bulk density (0.85 g/ml) than in PK (0.18 g/ml) and LK (0.38 g/ml). Both products had a good expansion. The yellow index decreased in PK (50.92) and LK (45.87) respect to RG (65.64). The largest was CPA (58.54). In all the products, the precooking increased the index of absorption, solubility and swelling power. Also, they showed major pasting temperature, low peak viscosity and breakdown viscosity. In both formulated products, the content of total, soluble and insoluble dietary fibre decreased during the precooking process. The content of protein was optimal (between 14.57-14.59 g/100g). PK had high acceptability (5.84), preference (84.48%), purchase (38.79%) and consumption (43.96%) intention. The lowest was CPA. This work demonstrates that it’s feasible to make precooked products with good quality characteristics, chemical composition and acceptability for the development of new products.

Check all that apply (CATA) as an instrument for the development of fish products

Abstract The objective of this paper is to develop a fish-based product. Through the innovative sensorial check all that apply (CATA) technique, employed in two stages of the development of the product – market research and the sensorial and hedonistic characterization of the final product – the aim was to develop a fish by-product that could respond to the needs of the consumer market. Results showed that the CATA technique is an important instrument for researching the consumer market and indicated the kind of fish by-product to be developed and its desired features. Nugget was the resulting by-product. The second application of CATA made possible the sensorial description of the by-product as being crisp, with little fish odor, light in color, well-seasoned and tasty. Therefore, the CATA technique proved to be an important research instrument in the fish consumption market as well as a quick technique for the complete description of fish nuggets.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Sensibility of the PCR technique in the detection of Stenocarpella sp. associated with maize seeds

Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.