997 resultados para Modificações
Resumo:
Os herbicidas, mesmo quando usados em doses reduzidas ou utilizados como maturadores, podem alterar a morfofisiologia da planta, o que pode levar a modificações qualitativas e quantitativas na produção. O presente estudo objetivou avaliar a eficiência agronômica e os efeitos, durante o crescimento da cana-soca, da aplicação de glyphosate e sulfometuron-methyl em baixas doses. O delineamento experimental utilizado foi o de blocos casualizados, com quatro repetições. Os tratamentos foram constituídos pelos herbicidas sulfometuron-methyl e glyphosate em diferentes doses e misturas e por uma testemunha (sem aplicação dos produtos). Uma linha de plantas de cana-de-açúcar foi destinada à aferição da qualidade tecnológica, sendo estabelecido 1 m aleatório a cada época de amostragem. Os colmos coletados foram submetidos ao desponte na altura da gema apical e à desfolha; em seguida, foram encaminhados para processamento segundo a metodologia do Sistema de Pagamento de Cana pelo Teor de Sacarose (SPCTS), sendo considerados os parâmetros tecnológicos: pol cana (PCC), pureza do caldo (PUI), açúcar total recuperável (ATR) e Brix. Nas soqueiras de cana-de-açúcar, realizaram-se análises de crescimento (altura e perfilhos). As avaliações foram realizadas na pré-colheita (30 dias após aplicação dos maturadores) e 30, 60, 90, 120, 150 e 180 dias após a colheita. Os herbicidas glyphosate e sulfometuron-methyl propiciaram melhoria da qualidade tecnológica da matéria-prima,com incrementos significativos na pureza do caldo e no Brix. A aplicação dos produtos não interferiu na produtividade e no teor de açúcar. Houve efeito estimulante no perfilhamento quando se usou glyphosate na dose de 400 mL ha-1 e redução em crescimento (altura) no início do desenvolvimento da cana, porém, com o tempo, o efeito não se manteve.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The formation of paraffin deposits is common in the petroleum industry during production, transport and treatment stages. It happens due to modifications in the thermodynamic variables that alter the solubility of alkanes fractions present in petroleum. The deposition of paraffin can provoke significant and growing petroleum losses, arriving to block the flow, hindering to the production. This process is associated with the phases equilibrium L-S and the stages and nucleation, growth and agglomeration the crystals. That process is function of petroleum intrinsic characteristics and temperature and pressure variations, during production. Several preventive and corrective methods are used to control the paraffin crystallization, such as: use of chemical inhibitors, hot solvents injection, use of termochemistry reactions, and mechanical removal. But for offshore exploration this expensive problem needs more investigation. Many studies have been carried through Wax Appearance Temperature (WAT) of paraffin; therefore the formed crystals are responsible for the modification of the reologics properties of the oil, causing a lot off operational problems. From the determination of the WAT of a system it is possible to affirm if oil presents or not trend to the formation of organic deposits, making possible to foresee and to prevent problems of wax crystallization. The solvent n-paraffin has been widely used as fluid of perforation, raising the production costs when it is used in the removal paraffin deposits, needing an operational substitute. This study aims to determine the WAT of paraffin and the interference off additives in its reduction, being developed system paraffin/solvent/surfactant that propitiates the wax solubilization. Crystallization temperatures in varied paraffin concentrations and different solvents were established in the first stage of the experiments. In the second stage, using the methodology of variation of the photoelectric signal had been determined the temperature of crystallization of the systems and evaluated the interferences of additives to reduction of the WAT. The experimental results are expressed in function of the variations of the photoelectric signals during controlled cooling, innovating and validating this new methodology to determine WAT, relatively simple with relation the other applied that involve specific equipments and of high cost. Through the curves you differentiate of the results had been also identified to the critical stages of growth and agglomeration of the crystals that represent to the saturation of the system, indicating difficulties of flow due to the increase of the density
Resumo:
Solid substrate cultivation (SSC) has become an efficient alternative towards rational use of agro industrial wastes and production of value-added products, mainly in developing countries. This work presents the production and functional application results of phenolic extracts obtained by solid substrate cultivation of pineapple (Ananas comosus L.) and guava (Psidium guajava L.) residues associated to soy flour and bioprocessed by Rhizopus oligosporus fungus. Two experimental groups were tested: (1) 9g of fruit residue and 1g of soy flour (A9 or G9); (2) 5g of fruit residue and 5g of soy flour (A5 or G5). After SSC, 100ml of distilled water was added to each Erlenmeyer flask containing 10g of bioprocessed material in order to obtain the phenolic extracts. Samples were taken every two days for total phenolic concentration (TPC) and antioxidant capacity evaluation by DPPH test during 12-day cultivation. The 2-day and 10-d ay extracts were selected and concentrated by ebullition until 1/10 of original volume was reached. After that, both non-concentrated and concentrated extracts were evaluated for their antimicrobial activity against Staphylococcus aureus and Salmonella enterica and a-amylase inhibitory capacity. It was observed an inverse relationship between total phenolic concentration (TPC) and antioxidant capacity during the cultivation. Besides that, the concentrated pineapple samples after two days were able to inhibit both pathogens tested, especially S. aureus. Guava concentrated extracts after 2 days showed expressive inhibition against S. enterica, but negative results against S. aureus growth. When it comes to a-amylase inhibition, A9 extracts after 2 days, both concentrated or not, completely inhibited enzyme activity. Similar behavior was observed for G9 samples, but only for concentrated samples. It was shown that concentration by ebullition positively affected the enzymatic inhibition of G9 and A9 samples, but on the other side, decreased antiamylase activity of A5 and G5 samples
Resumo:
The WAT is the temperature at the beginning of the appearance of wax crystals. At this temperature the first wax crystals are formed by the cooling systems paraffin / solvents. Paraffins are composed of a mixture of saturated hydrocarbons of high molecular weight. The removal of petroleum from wells and the production lines means a surcharge on produced oil, thus solubilize these deposits formed due to modifications of thermodynamics has been a constant challenge for companies of oil exploration. This study combines the paraffin solubilization by microemulsion systems, the determination of WAT systems paraffin / solvent and performance of surfactant in reducing the crystallization. We used the methods: rheological and the photoelectric signal, validating the latter which was developed to optimize the data obtained due to sensitivity of the equipment used. Methods developed for description of wax precipitation are often in poor agreement with the experimental data, they tend to underestimate the amount of wax at temperatures below the turbidity point. The Won method and the Ideal solution method were applied to the WAT data obtained in solvent systems, best represented by the second interaction of Won method using the solvents naphtha, hexane and LCO. It was observed that the results obtained by WAT photoelectric signal when compared with the viscosity occur in advance, demonstrating the greatest sensitivity of the method developed. The ionic surfactant reduced the viscosity of the solvent systems as it acted modifying the crystalline structure and, consequently, the pour point. The curves show that the WAT experimental data is, in general, closer to the modeling performed by the method of Won than to the one performed by the ideal solution method, because this method underestimates the curve predicting the onset of paraffin hydrocarbons crystallization temperature. This occurs because the actual temperature measured was the crystallization temperature and the method proposes the fusion temperature measurement.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
A implementação da espectrometria de massa (MS) para as análises de peptídeos (MS) e de aminoácidos (MS em tandem ou MS/MS) tornou possível a identificação de centenas de proteínas em experimentos únicos. Uma grande variedade de estratégias está disponível atualmente para o fracionamento e a purificação de amostras, a identificação de proteínas, a quantificação, a análise de modificações pós-traducionais (MPT's) e os estudos de interação. Dessa forma, a proteômica abre novas perspectivas na biologia de plantas com ênfase nos estudos de variabilidade genética, estresses fisiológicos e desenvolvimento de plantas.