995 resultados para Intestinal mucosa barrier
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
We aimed to evaluate the effectiveness and safety of bismuth-containing quadruple therapy plus postural change after dosing for Helicobacter pylori eradication in gastrectomized patients. We compared 76 gastric stump patients with H. pylori infection (GS group) with 50 non-gastrectomized H. pylori-positive patients who met the treatment indication (controls). The GS group was divided into GS group 1 and GS group 2. All groups were administered bismuth potassium citrate (220 mg), esomeprazole (20 mg), amoxicillin (1.0 g), and furazolidone (100 mg) twice daily for 14 days. GS group 1 maintained a left lateral horizontal position for 30 min after dosing. H. pylori was detected using rapid urease testing and histologic examination of gastric mucosa before and 3 months after therapy. Mucosal histologic manifestations were evaluated using visual analog scales of the updated Sydney System. GS group 1 had a higher prevalence of eradication than the GS group 2 (intention-to-treat [ITT]: P=0.025; per-protocol [PP]: P=0.030), and the control group had a similar prevalence. GS group 2 had a lower prevalence of eradication than controls (ITT: P=0.006; PP: P=0.626). Scores for chronic inflammation and activity declined significantly (P<0.001) 3 months after treatment, whereas those for atrophy and intestinal metaplasia showed no significant change. Prevalence of adverse reactions was similar among groups during therapy (P=0.939). A bismuth-containing quadruple therapy regimen plus postural change after dosing appears to be a relatively safe, effective, economical, and practical method for H. pylori eradication in gastrectomized patients.
Resumo:
Angiogenesis and lymphangiogenesis are thought to play a role in the pathogenesis of inflammatory bowel diseases (IBD). However, it is not understood if inflammatory lymphangiogenesis is a pathological consequence or a productive attempt to resolve the inflammation. This study investigated the effect of lymphangiogenesis on intestinal inflammation by overexpressing a lymphangiogenesis factor, vascular endothelial growth factor-C (VEGF-C), in a mouse model of acute colitis. Forty eight-week-old female C57BL/6 mice were treated with recombinant adenovirus overexpressing VEGF-C or with recombinant VEGF-C156S protein. Acute colitis was then established by exposing the mice to 5% dextran sodium sulfate (DSS) for 7 days. Mice were evaluated for disease activity index (DAI), colonic inflammatory changes, colon edema, microvessel density, lymphatic vessel density (LVD), and VEGFR-3mRNA expression in colon tissue. When acute colitis was induced in mice overexpressing VEGF-C, there was a significant increase in colonic epithelial damage, inflammatory edema, microvessel density, and neutrophil infiltration compared to control mice. These mice also exhibited increased lymphatic vessel density (73.0±3.9 vs 38.2±1.9, P<0.001) and lymphatic vessel size (1974.6±104.3 vs 1639.0±91.5, P<0.001) compared to control mice. Additionally, the expression of VEGFR-3 mRNA was significantly upregulated in VEGF-C156S mice compared to DSS-treated mice after induction of colitis (42.0±1.4 vs 3.5±0.4, P<0.001). Stimulation of lymphangiogenesis by VEGF-C during acute colitis promoted inflammatory lymphangiogenesis in the colon and aggravated intestinal inflammation. Inflammatory lymphangiogenesis may have pleiotropic effects at different stages of IBD.
Resumo:
Os índices séricos de glicose e lipídios, a microbiota intestinal e a produção de ácidos graxos voláteis de cadeias curtas (AGV) foram determinados em ratos Wistar submetidos às dietas: padrão (AIN-P), padrão modificada (AIN-M) e às dietas contendo frações de parede celular de levedura: glicana insolúvel (GI), manana (M) e glicana mais manana (G+M), como única fonte de fibra alimentar. O fracionamento da parede celular (PC) foi realizado por processos físicos e químicos de extração, centrifugação e secagem em "spray dryer". Os índices séricos foram dosados através de "kits" comerciais. A microbiota e a produção de AGV foram determinadas nos conteúdos intestinais, incluindo cólon, ceco e reto. Considerando os níveis de colesterol no tempo (T0) e no tempo 28 (T28), as dietas AIN-P, AIN-M e M apresentaram efeito hipocolesterolêmico, tendo em vista que a composição das dietas eram de natureza hipercolesterolêmica. Em relação à glicose sérica, no tempo (T0) observou-se uma elevação geral da glicemia, sugerindo um efeito hiperglicêmico das dietas estudadas. A dieta G+M foi a que apresentou valores significantemente mais elevados de lipídios séricos no tempo T14, e os níveis mais baixos foram observados na dieta M e na dieta GI no T14 e nas dietas AIN-M e AIN-P. A dieta AIN-P foi a que apresentou valor significantemente mais elevado de triacilgliceróis nos tempos T14 e T28. Os níveis mais baixos nos tempos T14 foram constatados para as dietas G+M e GI e no tempo T28 para as dietas AIN-M e M. De um modo geral, não houve modificações significativas na microbiota intestinal dos animais em nenhuma das dietas. Dentre os AGV, o ácido acético foi o predominante, seguido do propiônico e do butírico, em todas as dietas estudadas.