Optimal 3D surface reconstruction from a small number of conventional 2D X-ray images

This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.

Practical interface experiments with implant technology

In this paper results are shown to indicate the efficacy of a direct connection between the human nervous system and a computer network. Experimental results obtained thus far from a study lasting for over 3 months are presented, with particular emphasis placed on the direct interaction between the human nervous system and a piece of wearable technology. An overview of the present state of neural implants is given, as well as a range of application areas considered thus far. A view is also taken as to what may be possible with implant technology as a general purpose human-computer interface for the future.

Alignment of a model amyloid peptide fragment in bulk and at a solid surface

The alignment of model amyloid peptide YYKLVFFC is investigated in bulk and at a solid surface using a range of spectroscopic methods employing polarized radiation. The peptide is based on a core sequence of the amyloid beta (A beta) peptide, KLVFF. The attached tyrosine and cysteine units are exploited to yield information on alignment and possible formation of disulfide or dityrosine links. Polarized Raman spectroscopy on aligned stalks provides information on tyrosine orientation, which complements data from linear dichroism (LD) on aqueous solutions subjected to shear in a Couette cell. LD provides a detailed picture of alignment of peptide strands and aromatic residues and was also used to probe the kinetics of self-assembly. This suggests initial association of phenylalanine residues, followed by subsequent registry of strands and orientation of tyrosine residues. X-ray diffraction (XRD) data from aligned stalks is used to extract orientational order parameters from the 0.48 nm reflection in the cross-beta pattern, from which an orientational distribution function is obtained. X-ray diffraction on solutions subject to capillary flow confirmed orientation in situ at the level of the cross-beta pattern. The information on fibril and tyrosine orientation from polarized Raman spectroscopy is compared with results from NEXAFS experiments on samples prepared as films on silicon. This indicates fibrils are aligned parallel to the surface, with phenyl ring normals perpendicular to the surface. Possible disulfide bridging leading to peptide dimer formation was excluded by Raman spectroscopy, whereas dityrosine formation was probed by fluorescence experiments and was found not to occur except under alkaline conditions. Congo red binding was found not to influence the cross-beta XRD pattern.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Self-assembly of PEGylated peptide conjugates containing a modified amyloid β-peptide fragment

The self-assembly of PEGylated peptides containing a modified sequence from the amyloid beta peptide, FEK LVFF, has been studied in aqueous solution. PEG molar masses PEG1k, PEG2k, and PEG10k were used in the conjugates. It is shown that the three FFK LVFF-PEG hybrids form fibrils comprising a FFKLVFF core and a PEG corona. The beta-sheet secondary structure of the peptide is retained in the FFK LVFF fibril core. At sufficiently high concentrations, FEK LVFF-PEG1k and FEK LVFF-PEG2k form a nema tic phase, while PEG10k-FEK LVFF exhibits a hexagonal columnar phase. Simultaneous small angle neutron scattering/shear flow experiments were performed to study the shear flow alignment of the nematic and hexagonal liquid crystal phases. On drying, PEG crystallization occurs without disruption of the FFK LVFF beta-sheet structure leading to characteristic peaks in the X-ray diffraction pattern and FTIR spectra. The stability of beta-sheet structures was also studied in blends of FFKLVFF-PEG conjugates with poly(acrylic acid) (PAA). While PEG crystallization is only observed up to 25% PAA content in the blends, the FFK LVFF beta-sheet structure is retained up to 75% PAA.