An observational study of the 7 September 2005 Barcelona tornado outbreak

This paper presents an observational study of the tornado outbreak that took place on the 7 September 2005 in the Llobregat delta river, affecting a densely populated and urbanised area and the Barcelona International airport (NE Spain). The site survey confirmed at least five short-lived tornadoes. Four of them were weak (F0, F1) and the other one was significant (F2 on the Fujita scale). They started mostly as waterspouts and moved later inland causing extensive damage estimated in 9 million Euros, three injured people but fortunately no fatalities. Large scale forcing was provided by upper level diffluence and low level warm air advection. Satellite and weather radar images revealed the development of the cells that spawned the waterspouts along a mesoscale convergence line in a highly sheared and relatively low buoyant environment. Further analysis indicated characteristics that could be attributed indistinctively to non-supercell or to mini-supercell thunderstorms.

Mise en place d'un cathéter veineux central chez l'adulte. 1. Indications, précautions et complications [Bases of central venous catheterization]

La pose d'un cathéter veineux central est un geste fréquent dans un service de médecine interne. En suivant la formation des médecins-assistants, nous nous sommes aperçus que certaines questions, doutes ou craintes concernant cette procédure nous sont régulièrement adressées: «Est-ce qu'un cathéter sous-clavier peut être posé avec une thrombocytopénie modérée?»; «Quel site de ponction présente le moins de risques pour le patient?»; «Après combien de jours un cathéter doit-il être changé?». Cet article se propose de répondre à ces questions et à d'autres, en partant d'une mini-revue de la littérature actuelle. Central venous catheterization is a frequently performed procedure in internal medicine units. Residents in training frequently share the same questions, doubts and fears about this procedure : "Should I perform a subclavian catheterization in a patient with mild thrombopenia?"; "Which site has the lesser complication rate?"; "After how long does a catheter need to be replaced?". This mini-review of the current literature tries to answer this and other questions

Potential role of pathogen signaling in multitrophic plant-microbe interactions involved in disease protection.

Multitrophic interactions mediate the ability of fungal pathogens to cause plant disease and the ability of bacterial antagonists to suppress disease. Antibiotic production by antagonists, which contributes to disease suppression, is known to be modulated by abiotic and host plant environmental conditions. Here, we demonstrate that a pathogen metabolite functions as a negative signal for bacterial antibiotic biosynthesis, which can determine the relative importance of biological control mechanisms available to antagonists and which may also influence fungus-bacterium ecological interactions. We found that production of the polyketide antibiotic 2,4-diacetylphloroglucinol (DAPG) was the primary biocontrol mechanism of Pseudomonas fluorescens strain Q2-87 against Fusarium oxysporum f. sp. radicis-lycopersici on the tomato as determined with mutational analysis. In contrast, DAPG was not important for the less-disease-suppressive strain CHA0. This was explained by differential sensitivity of the bacteria to fusaric acid, a pathogen phyto- and mycotoxin that specifically blocked DAPG biosynthesis in strain CHA0 but not in strain Q2-87. In CHA0, hydrogen cyanide, a biocide not repressed by fusaric acid, played a more important role in disease suppression.

On some numerical aspects of an active strain model in cardiac mechanics

We are interested in the development, implementation and testing of an orthotropic model for cardiac contraction based on an active strain decomposition. Our model addresses the coupling of a transversely isotropic mechanical description at the cell level, with an orthotropic constitutive law for incompressible tissue at the macroscopic level. The main differences with the active stress model are addressed in detail, and a finite element discretization using Taylor-Hood and MINI elements is proposed and illustrated with numerical examples.

CHARACTERIZATION OF NrsZ, A NOVEL SMALL REGULATORY NON-CODING RNA INVOLVED IN THE ADAPTATION OF PSEUDOMONAS AERUGINOSA PAO1

The opportunistic ubiquitous pathogen Pseudomonas aeruginosa strain PAOl is a versatile Gram-negative bacterium that has the extraordinary capacity to colonize a wide diversity of ecological niches and to cause severe and persistent infections in humans. To ensure an optimal coordination of the genes involved in nutrient utilization, this bacterium uses the NtrB/C and/or the CbrA/B two-component systems, to sense nutrients availability and to regulate in consequence the expression of genes involved in their uptake and catabolism. NtrB/C is specialized in nitrogen utilization, while the CbrA/B system is involved in both carbon and nitrogen utilization and both systems activate their target genes expression in concert with the alternative sigma factor RpoN. Moreover, the NtrB/C and CbrA/B two- component systems regulate the secondary metabolism of the bacterium, such as the production of virulence factors. In addition to the fine-tuning transcriptional regulation, P. aeruginosa can rapidly modulate its metabolism using small non-coding regulatory RNAs (sRNAs), which regulate gene expression at the post-transcriptional level by diverse and sophisticated mechanisms and contribute to the fast physiological adaptability of this bacterium. In our search for novel RpoN-dependent sRNAs modulating the nutritional adaptation of P. aeruginosa PAOl, we discovered NrsZ (Nitrogen regulated sRNA), a novel RpoN-dependent sRNA that is induced under nitrogen starvation by the NtrB/C two-component system. NrsZ has a unique architecture, formed of three similar stem-loop structures (SL I, II and II) separated by variant spacer sequences. Moreover, this sRNA is processed in short individual stem-loop molecules, by internal cleavage involving the endoribonuclease RNAse E. Concerning NrsZ functions in P. aeruginosa PAOl, this sRNA was shown to trigger the swarming motility and the rhamnolipid biosurfactants production. This regulation is due to the NrsZ-mediated activation of rhlA expression, a gene encoding for an enzyme essential for swarming motility and rhamnolipids production. Interestingly, the SL I structure of NrsZ ensures its regulatory function on rhlA expression, suggesting that the similar SLs are the functional units of this modular sRNA. However, the regulatory mechanism of action of NrsZ on rhlA expression activation remains unclear and is currently being investigated. Additionally, the NrsZ regulatory network was investigated by a transcriptome analysis, suggesting that numerous genes involved in both primary and secondary metabolism are regulated by this sRNA. To emphasize the importance of NrsZ, we investigated its conservation in other Pseudomonas species and demonstrated that NrsZ is conserved and expressed under nitrogen limitation in Pseudomonas protegens Pf-5, Pseudomonas putida KT2442, Pseudomonas entomophila L48 and Pseudomonas syringae pv. tomato DC3000, strains having different ecological features, suggesting an important role of NrsZ in the adaptation of Pseudomonads to nitrogen starvation. Interestingly the architecture of the different NrsZ homologs is similarly composed by SL structures and variant spacer sequences. However, the number of SL repetitions is not identical, and one to six SLs were predicted on the different NrsZ homologs. Moreover, NrsZ is processed in short molecules in all the strains, similarly to what was previously observed in P. aeruginosa PAOl, and the heterologous expression of the NrsZ homologs restored rhlA expression, swarming motility and rhamnolipids production in the P. aeruginosa NrsZ mutant. In many aspects, NrsZ is an atypical sRNA in the bacterial panorama. To our knowledge, NrsZ is the first described sRNA induced by the NtrB/C. Moreover, its unique modular architecture and its processing in similar short SL molecules suggest that NrsZ belongs to a novel family of bacterial sRNAs. -- L'agent pathogène opportuniste et ubiquitaire Pseudomonas aeruginosa souche PAOl est une bactérie Gram négative versatile ayant l'extraordinaire capacité de coloniser différentes niches écologiques et de causer des infections sévères et persistantes chez l'être humain. Afin d'assurer une coordination optimale des gènes impliqués dans l'utilisation de différents nutriments, cette bactérie se sert de systèmes à deux composants tel que NtrB/C et CbrA/B afin de détecter la disponibilité des ressources nutritives, puis de réguler en conséquence l'expression des gènes impliqués dans leur importation et leur catabolisme. Le système NtrB/C régule l'utilisation des sources d'azote alors que le système CbrA/B est impliqué à la fois dans l'utilisation des sources de carbone et d'azote. Ces deux systèmes activent l'expression de leurs gènes-cibles de concert avec le facteur sigma alternatif RpoN. En outre, NtrB/C et CbrA/B régulent aussi le métabolisme secondaire, contrôlant notamment la production d'importants facteurs de virulence. En plus de toutes ces régulations génétiques fines ayant lieu au niveau transcriptionnel, P. aeruginosa est aussi capable de moduler son métabolisme en se servant de petits ARNs régulateurs non-codants (ARNncs), qui régulent l'expression génétique à un niveau post- transcriptionnel par divers mécanismes sophistiqués et contribuent à rendre particulièrement rapide l'adaptation physiologique de cette bactérie. Au cours de nos recherches sur de nouveaux ARNncs dépendant du facteur sigma RpoN et impliqués dans l'adaptation nutritionnelle de P. aeruginosa PAOl, nous avons découvert NrsZ (Nitrogen regulated sRNA), un ARNnc induit par la cascade NtrB/C-RpoN en condition de carence en azote. NrsZ a une architecture unique, composée de trois structures en tige- boucle (TB I, II et III) hautement similaires et séparées par des « espaceurs » ayant des séquences variables. De plus, cet ARNnc est clivé en petits fragments correspondant au trois molécules en tige-boucle, par un processus de clivage interne impliquant l'endoribonucléase RNase E. Concernant les fonctions de NrsZ chez P. aeruginosa PAOl, cet ARNnc est capable d'induire la motilité de type « swarming » et la production de biosurfactants, nommés rhamnolipides. Cette régulation est due à l'activation par NrsZ de l'expression de rhlA, un gène essentiel pour la motilité de type swarming et pour la production de rhamnolipides. Étonnamment, la structure TB I est capable d'assurer à elle seule la fonction régulatrice de NrsZ sur l'expression de rhlA, suggérant que ces molécules TBs sont les unités fonctionnelles de cet ARNnc modulaire. Cependant, le mécanisme moléculaire par lequel NrsZ active l'expression de rhlA demeure à ce jour incertain et est actuellement à l'étude. En plus, le réseau de régulations médiées par NrsZ a été étudié par une analyse de transcriptome qui a indiqué que de nombreux gènes impliqués dans le métabolisme primaire ou secondaire seraient régulés par NrsZ. Pour accentuer l'importance de NrsZ, nous avons étudié sa conservation dans d'autres espèces de Pseudomonas. Ainsi, nous avons démontré que NrsZ est conservé et exprimé en situation de carence d'azote par les souches Pseudomonas protegens Pf-5, Pseudomonas putida KT2442, Pseudomonas entomophila L48, Pseudomonas syringae pv. tomato DC3000, quatre espèces ayant des caractéristiques écologiques très différentes, suggérant que NrsZ joue un rôle important dans l'adaptation du genre Pseudomonas envers la carence en azote. Chez toutes les souches étudiées, les différents homologues de NrsZ présentent une architecture similaire faite de TBs conservées et d'espaceurs. Cependant, le nombre de TBs n'est pas identique et peut varier de une à six copies selon la souche. Les différentes versions de NrsZ sont clivées en petites molécules dans ces quatre souches, comme il a été observé chez P. aeruginosa PAOl. De plus, l'expression hétérologue des différentes variantes de NrsZ est capable de restaurer l'expression de rhlA, la motilité swarming et la production de rhamnolipides dans une souche de P. aeruginosa dont nrsZ a été inactivé. Par bien des aspects, NrsZ est un ARNnc atypique dans le monde bactérien. À notre connaissance, NrsZ est le premier ARNnc décrit comme étant régulé par le système NtrB/C. De plus, son unique architecture modulaire et son clivage en petites molécules similaires suggèrent que NrsZ appartient à une nouvelle famille d'ARNncs bactériens.

Demyelination of superficial white matter in early Alzheimer's disease: a magnetization transfer imaging study.

Assuming selective vulnerability of short association U-fibers in early Alzheimer's disease (AD), we quantified demyelination of the surface white matter (dSWM) with magnetization transfer ratio (MTR) in 15 patients (Clinical Dementia Rating Scale [CDR] 0.5-1; Functional Assessment Staging [FAST]: 3-4) compared with 15 controls. MTRs were computed for 39 areas in each hemisphere. We found a bilateral MTR decrease in the temporal, cingulate, parietal, and prefrontal areas. With linear discriminant analysis, we successfully classified all the participants with 3 variates including the cuneus, parahippocampal, and superior temporal regions of the left hemisphere. The pattern of dSWM changed with the age of AD onset. In early onset patients, we found bilateral posterior demyelination spreading to the temporal areas in the left hemisphere. The late onset patients showed a distributed bilateral pattern with the temporal and cingulate areas strongly affected. A correlation with Mini Mental State Examination (MMSE), Lexis, and memory tests revealed the dSWM impact on cognition. A specific landscape of dSWM in early AD shows the potential of MTR imaging as an in vivo biomarker superior to currently used techniques.

Automated DNA extraction using the QIAsymphony platform: Estimation of DNA recovery from simulated forensic stains

The aim of this study was to evaluate the forensic protocol recently developed by Qiagen for the QIAsymphony automated DNA extraction platform. Samples containing low amounts of DNA were specifically considered, since they represent the majority of samples processed in our laboratory. The analysis of simulated blood and saliva traces showed that the highest DNA yields were obtained with the maximal elution volume available for the forensic protocol, that is 200 ml. Resulting DNA extracts were too diluted for successful DNA profiling and required a concentration. This additional step is time consuming and potentially increases inversion and contamination risks. The 200 ml DNA extracts were concentrated to 25 ml, and the DNA recovery estimated with real-time PCR as well as with the percentage of SGM Plus alleles detected. Results using our manual protocol, based on the QIAamp DNA mini kit, and the automated protocol were comparable. Further tests will be conducted to determine more precisely DNA recovery, contamination risk and PCR inhibitors removal, once a definitive procedure, allowing the concentration of DNA extracts from low yield samples, will be available for the QIAsymphony.

Disorders Among Iowa Inmates Higher Than Previously Assessed, Data Download, Iowa Department of Corrections, May 2008

A newly released study shows that the prevalence of mental health and substance abuse disorders among Iowa’s inmate population is even higher than earlier findings indicated. Using the MINI-Plus assessment tool, University of Iowa researchers screened a randomly selected group of 320 incoming nonviolent offenders at IMCC from 2005 to 2007. DOC’s Director of Mental Health Services, Dr. Bruce Sieleni, participated in the study.

Herniectomie percutanée sous guidage scanner : 7 ans d?experience.

Objectifs: Relater notre expérience des herniectomies sous guidage scanner des conflits disco-radiculaires résistants au traitement médical et aux infiltrationsradio-guidées. Decrire les techniques, indications, contre-indications et limites de ces procédures. Matériels et méthodes: De janvier 2004 à janvier 2011, plus de 1000 herniectomies ont été réalisées dans notre institution. L'intervention se déroule en salle de scanner interventionnelavec arceau de scopie. Ce guidage permet de positionner le matériel d'extraction exactement dans la hernie discale. Résultats: Les herniectomies sont réalisées lorsque l'indication chirurgicale classique est posée . Le principe de l'intervention est similaire à la chirurgie standard , et consisteen une extraction du matériel nucléaire hernié sous-ligamentaire, mais sous anesthésie locale et percutané. Notre expérience confirme que cette procédure estune alternative mini-invasive très efficace dans les positions latérales et foraminales en raison de leur accès direct facile au scanner . Les résultats statistiquesdétaillés seront exposés. Conclusion: La herniectomie sous guidage scanner est une intervention tres efficace dans les conflits disco -radiculaires en particulier foraminaux. Elle est devenu en moinsde 7 ans dans notre institution l'intervention de première intention dans le traitement de la hernie foraminale résistante aux thérapeutiques médicales .

Minimal clinically meaningful differences for the EORTC QLQ-C30 and EORTC QLQ-BN20 scales in brain cancer patients.

BACKGROUND: We aimed to determine the smallest changes in health-related quality of life (HRQoL) scores in the European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire core 30 and the Brain Cancer Module (QLQ-BN20), which could be considered as clinically meaningful in brain cancer patients. Materials and methods: World Health Organisation performance status (PS) and mini-mental state examination (MMSE) were used as clinical anchors appropriate to related subscales to determine the minimal clinically important differences (MCIDs) in HRQoL change scores (range 0-100) in the QLQ-C30 and QLQ-BN20. A threshold of 0.2 standard deviation (SD) (small effect) was used to exclude anchor-based MCID estimates considered too small to inform interpretation. RESULTS: Based on PS, our findings support the following integer estimates of the MCID for improvement and deterioration, respectively: physical (6, 9), role (14, 12), and cognitive functioning (8, 8); global health status (7, 4*), fatigue (12, 9), and motor dysfunction (4*, 5). Anchoring with MMSE, cognitive functioning MCID estimates for improvement and deterioration were (11, 2*) and for communication deficit were (9, 7). Estimates with asterisks were <0.2 SD and were excluded from our MCID range of 5-14. CONCLUSION: These estimates can help clinicians evaluate changes in HRQoL over time, assess the value of a health care intervention and can be useful in determining sample sizes in designing future clinical trials.

Antecedents, psychiatric characteristics and follow-up of adolescents hospitalized for suicide attempt of overwhelming suicidal ideation.

OBJECTIVES: To evaluate the socio-demographic as well as the health and psychiatric profiles of adolescents hospitalised for suicide attempt or overwhelming suicide ideation and to assess repetition of suicide attempt over a period of 18 months. PATIENTS AND METHODS: Between April 2000 and September 2001, all patients aged 16 to 21 years admitted to the University Hospitals of Geneva and Lausanne for suicide attempt or ideation were included in the study. At this time (T0) semi-structured face to face interviews were conducted to identify socio-demographic data, mental health and antecedents regarding suicidal conducts. Current psychiatric status was assessed with the MINI (Mini International Neuropsychiatric Instrument). At T1 and T2, reassessments included psychiatric status (MINI) as well as lifestyles, socio-professional situation and suicidal behaviours. RESULTS: At T0, 269 subjects met the study criteria, among whom 83 subjects (56 girls and 27 boys) left the hospital too quickly to be involved or refused to participate in the study (final sample at T0: 149 girls; 37 boys). The participation rate at T1 and T2 was respectively 66% and 62% of the original sample. The percentage of adolescents meeting the criteria for psychiatric diagnoses (91%) was high: affective disorder (78%); anxiety disorder (64%); substance use disorder (39%); eating disorder (9%); psychotic disorder (11%); antisocial personality (7%) with most subjects (85%) having more than one disorder. Around 90% of the subjects interviewed at T1, and/or T2, had received follow-up care after their hospitalisation, either by a primary care physician or a psychotherapist or both. Two subjects died of violent death and 18% made a further suicide attempt. CONCLUSION: Most adolescents hospitalised for suicidal episodes suffer from psychiatric problems which should be addressed by a careful psychiatric assessment, followed up if needed by a structured after care plan.

DNA extraction using the QIAsymphony: Evaluation of PCR inhibitor removal

The goal of this study was to compare the quantity and purity of DNA extracted from biological tracesusing the QIAsymphony robot with that of the manual QIAamp DNA mini kit currently in use in ourlaboratory. We found that the DNA yield of robot was 1.6-3.5 times lower than that of the manualprotocol. This resulted in a loss of 8% and 29% of the alleles correctly scored when analyzing 1/400 and 1/800 diluted saliva samples, respectively. Specific tests showed that the QIAsymphony was at least 2-16times more efficient at removing PCR inhibitors. The higher purity of the DNA may therefore partlycompensate for the lower DNA yield obtained. No case of cross-contamination was observed amongsamples. After purification with the robot, DNA extracts can be automatically transferred in 96-wellsplates, which is an ideal format for subsequent RT-qPCR quantification and DNA amplification. Lesshands-on time and reduced risk of operational errors represent additional advantages of the robotic platform.

Expression of MYC, IgM, As Well As Non-Germinal Centre B-Cell Like Immunophenotype and Positive Immunofish Index Predict a Worse Progression Free Survival and Overall Survival in a Series of 670 De Novo Diffuse Large B-Cell Lymphomas Included in Clinical Trials: A GELA Study of the 2003 Program

Introduction: Diffuse large B-cell lymphomas (DLBCL) represent a heterogeneous disease with variable clinical outcome. Identifying phenotypic biomarkers of tumor cells on paraffin sections that predict different clinical outcome remain an important goal that may also help to better understand the biology of this lymphoma. Differentiating non-germinal centre B-cell-like (non-GCB) from Germinal Centre B-cell-like (GCB) DLBCL according to Hans algorithm has been considered as an important immunohistochemical biomarker with prognostic value among patients treated with R-CHOP although not reproducibly found by all groups. Gene expression studies have also shown that IgM expression might be used as a surrogate for the GCB and ABC subtypes with a strong preferential expression of IgM in ABC DLBCL subtype. ImmunoFISH index based on the differential expression of MUM-1, FOXP1 by immunohistochemistry and on the BCL6 rearrangement by FISH has been previously reported (C Copie-Bergman, J Clin Oncol. 2009;27:5573-9) as prognostic in an homogeneous series of DLBCL treated with R-CHOP. In addition, oncogenic MYC protein overexpression by immunohistochemistry may represent an easy tool to identify the consequences of MYC deregulation in DLBCL. Our aim was to analyse by immunohistochemistry the prognostic relevance of MYC, IgM, GCB/nonGCB subtype and ImmunoFISH index in a large series of de novo DLBCL treated with Rituximab (R)-chemotherapy (anthracyclin based) included in the 2003 program of the Groupe d'Etude des Lymphomes de l'Adulte (GELA) trials. Methods: The 2003 program included patients with de novo CD20+ DLBCL enrolled in 6 different LNH-03 GELA trials (LNH-03-1B, -B, -3B, 39B, -6B, 7B) stratifying patients according to age and age-adjusted IPI. Tumor samples were analyzed by immunohistochemistry using CD10, BCL6, MUM1, FOXP1 (according to Barrans threshold), MYC, IgM antibodies on tissue microarrays and by FISH using BCL6 split signal DNA probes. Considering evaluable Hans score, 670 patients were included in the study with 237 (35.4%) receiving intensive R-ACVBP regimen and 433 (64.6%) R-CHOP/R-mini-CHOP. Results: 304 (45.4%) DLBCL were classified as GCB and 366 (54.6%) as non-GCB according to Hans algorithm. 337/567 cases (59.4%) were positive for the ImmunoFISH index (i.e. two out of the three markers positive: MUM1 protein positive, FOXP1 protein Variable or Strong, BCL6 rearrangement). Immunofish index was preferentially positive in the non-GCB subtype (81.3%) compared to the GCB subtype (31.2%), (p<0.001). IgM was recorded as positive in tumor cells in 351/637 (52.4%) DLBCL cases with a preferential expression in non-GCB 195 (53.3%) vs GCB subtype 100(32.9%), p<0.001). MYC was positive in 170/577 (29.5%) cases with a 40% cut-off and in 44/577 (14.2%) cases with a cut-off of 70%. There was no preferential expression of MYC among GCB or non-GCB subtype (p>0.4) for both cut-offs. Progression-free Survival (PFS) was significantly worse among patients with high IPI score (p<0.0001), IgM positive tumor (p<0.0001), MYC positive tumor with a 40% threshold (p<0.001), ImmunoFISH positive index (p<0.002), non-GCB DLBCL subtype (p<0.0001). Overall Survival (OS) was also significantly worse among patients with high IPI score (p<0.0001), IgM positive tumor (p=0.02), MYC positive tumor with a 40% threshold (p<0.01), ImmunoFISH positive index (p=0.02), non-GCB DLBCL subtype (p<0.0001). All significant parameters were included in a multivariate analysis using Cox Model and in addition to IPI, only the GCB/non-GCB subtype according to Hans algorithm predicted significantly a worse PFS among non-GCB subgroup (HR 1.9 [1.3-2.8] p=0.002) as well as a worse OS (HR 2.0 [1.3-3.2], p=0.003). This strong prognostic value of non-GCB subtyping was confirmed considering only patients treated with R- CHOP for PFS (HR 2.1 [1.4-3.3], p=0.001) and for OS (HR 2.3 [1.3-3.8], p=0.002). Conclusion: Our study on a large series of patients included in trials confirmed the relevance of immunohistochemistry as a useful tool to identify significant prognostic biomarkers for clinical use. We show here that IgM and MYC might be useful prognostic biomarkers. In addition, we confirmed in this series the prognostic value of the ImmunoFISH index. Above all, we fully validated the strong and independent prognostic value of the Hans algorithm, daily used by the pathologists to subtype DLBCL.

Screening for post-traumatic stress disorder (PTSD) in a psychiatric emergency setting

Background and Objectives: (i) to assess the prevalence of PTSD in a psychiatric emergency setting by means of a diagnostic instrument and to compare it with PTSD-prevalence of a clinically evaluated, historical sample; and (ii) to assess psychiatric residents' perception of the systematic use of this diagnostic instrument. Methods: A consecutive sample of patients (N = 403) evaluated for a psychiatric emergency was assessed with the module J (PTSD) of the MINI, the historical sample (N = 350), assessed by chart review, consisted of consecutive patients of the same setting evaluated one year prior to the study period. Residents' perceptions were assessed by means of a focus group. Results: While in only 0.57% of the historical sample (N = 350) a diagnosis of PTSD was recorded, 20.3% (N = 64) of the patients assessed with the diagnostic instrument (N = 316) qualified for a diagnosis of PTSD. Higher prevalence rates were observed in refugees and those without legal residency status (50%); patients from countries with a recent history of war (47.1%); those with four (44.4%) or three psychiatric co-morbidities (35.3%); migrants (29.8%) and patients without professional income (25%). Residents felt that the systematic use of the tool was not adequate in the psychiatric emergency setting for various reasons (e.g.: not suitable for a first or single consultation, negative impact on the clinical evaluation). Conclusions: The study confirms that PTSD is underdiagnosed in the psychiatric emergency setting. To improve the situation, targeted screening or educational and institutional strategies are needed.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.