986 resultados para T-lymphocytes, regulatory
Resumo:
To understand how a eukaryote achieves differential transcription of genes in precise spatial patterns, the molecular details of tissue specific expression of the Strongylocentrotus purpuratus Spec2a gene were investigated by functional studies of the cis-regulatory components in the upstream enhancer. Regional activation of Spec2a in the aboral ectoderm is conferred by a combination of activators and repressors. The positive regulators include previously identified SpOtx and a trans-regulatory factor binding at the CCAAT site in the Spec2a enhancer. The nuclear protein binding to the CCAAT box was determined to be the heterotrimeric CCAAT binding factor (SpCBF). SpCBF also mediates general activation in the ectoderm. The negative regulators consist of an oral ectoderm repressor (OER), an endoderm repressor (ENR), and an S. Purpuratus goosecoid homologue (SpGsc). OER functions to prevent expression in the oral ectoderm, while ENR is required to repress endoderm expression. SpGsc antagonizes the SpOtx function by competing for binding at SpOtx target genes in oral ectoderm, where it functions as an active repressor. Thus, SpOtx and SpGsc perform collectively to establish and maintain the oral-aboral axis. Finally, purification of ENR and OER proteins from sea urchin blastula stage nuclear extracts was performed using site-specific DNA-affmity chromatography. ^
Resumo:
Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^
Resumo:
B-lymphocyte stimulator (BLyS also called BAFF), is a potent cell survival factor expressed in many hematopoietic cells. BLyS levels are elevated in the serum of non-Hodgkin lymphoma (NHL) patients, and have been reported to be associated with disease progression, and prognosis. To understand the mechanisms involved in BLyS gene expression and regulation, we examined expression, function, and regulation of the BLyS gene in B cell non-Hodgkin's lymphoma (NHL-B) cells. BLyS is constitutively expressed in aggressive NHL-B cells including large B cell lymphoma (LBCL) and mantle cell lymphoma (MCL) contributing to survival and proliferation of malignant B cells. Two important transcription factors, NF-κB and NFAT, were found to be involved in regulating BLyS expression through at least one NF-κB and two NFAT binding sites in the BLyS promoter. Further study indicates that the constitutive activation of NF-κB and BLyS in NHL-B cells forms a positive feedback loop contributing to cell survival and proliferation. In order to further investigate BLyS signaling pathway, we studied the function of BAFF-R, a major BLyS receptor, on B cells survival and proliferation. Initial study revealed that BAFF-R was also found in the nucleus, in addition to its presence on plasma membrane of B cells. Nuclear presentation of BAFF-R can be increased by anti-IgM and soluble BLyS treatment in normal peripheral B lymphocytes. Inhibition of BLyS expression decreases nuclear BAFF-R level in LBCL cells. Furthermore, we showed that BAFF-R translocated to nucleus through the classic karyopherin pathway. A candidate nuclear localization sequence (NLS) was identified in the BAFF-R protein sequence and mutation of this putative NLS can block BAFF-R entering nucleus and LBCL cell proliferation. Further study showed that BAFF-R co-localized with NF-κB family member, c-rel in the nucleus. We also found BAFF-R mediated transcriptional activity, which could be increased by c-rel. We also found that nuclear BAFF-R could bind to the NF-κB binding site on the promoters of NF-κB target genes such as BLyS, CD154, Bcl-xL, Bfl-1/A1 and IL-8. These findings indicate that BAFF-R may also promote survival and proliferation of normal B cells and NHL-B cells by directly functioning as a transcriptional co-factor with NF-κB family member. ^
Resumo:
Regulatory T cells expressing the fork-head box transcription factor 3 (Foxp3) play a central role in the dominant control of immunological tolerance. Compelling evidence obtained from both animal and clinical studies have now linked the expansion and accumulation of Foxp3+ regulatory T cells associated with tumor lesions to the failure of immune-mediated tumor rejection. However, further progress of the field is hampered by the gap of knowledge regarding their phenotypic, functional, and the developmental origins in which these tumor-associated Foxp3+ regulatory T cells are derived. Here, we have characterized the general properties of tumor-associated Foxp3+ regulatory T cells and addressed the issue of tumor microenvironment mediated de-novo induction by utilizing a well known murine tumor model MCA-205 in combination with our BAC Foxp3-GFP reporter mice and OT-II TCR transgenic mice on the RAG deficient background (RAG OT-II). De-novo induction defines a distinct mechanism of converting non-regulatory precursor cells to Foxp3+ regulatory T cells in the periphery as opposed to the expansion of pre-existing regulatory T cells formed naturally during thymic T cell development. This mechanism is of particularly importance to how tumors induce tumor-antigen-specific suppressor cells to subvert anti-tumor immune responses. Our study has found that tumor-associated Foxp3+ regulatory T cells are highly activated, undergo vigorous proliferation, are more potent by in-vitro suppression assays, and express higher levels of membrane-bound TGF-β1 than non-tumor regulatory T cells. With Foxp3-GFP reporter mice or RAG OT-II TCR transgenic mice, we show that tumor tissue can induce detectable de-novo generation of Foxp3+ regulatory T cells of both polyclonal or antigen specific naïve T cells. This process was not only limited for subcutaneous tumors but for lung tumors as well. Furthermore, this process required the inducing antigen to be co-localized within the tumor tissue. Examination of tumor tissue revealed an abundance of myeloid CD11b+ antigen-presenting cells that were capable of inducing Foxp3+ regulatory T cells. Taken together, these findings elucidate the general attributes and origins of tumor-associated Foxp3+ regulatory T cells in the tumor microenvironment and in their role in the negative regulation of tumor immunity.^
Resumo:
Several immune pathologies are the result of aberrant regulation of T lymphocytes. Pronounced T cell proliferation can result in autoimmunity or hematologic malignancy, whereas loss of T cell activity can manifest as immunodeficiency. Thus, there is a critical need to characterize the signal transduction pathways that mediate T cell activation so that novel and rational strategies to detect and effectively control T cell mediated disease can be achieved. ^ The first objective of this dissertation was to identify and characterize novel T cell regulatory proteins that are differentially expressed upon antigen induced activation. Using a functional proteomics approach, two members of the prohibitin (Phb) family of proteins, Phb1 and Phb2, were determined to be upregulated upon activation of primary human T cells. Furthermore, their regulated expression was dependent upon CD3 and CD28 signaling pathways which synergistically increased their expression. In contrast to previous reports of Phb nuclear localization, both proteins were determined to localize to the mitochondrial inner membrane of human T cells. Additionally, novel Phb phosphorylation sites were identified and characterized using mass spectrometry, phosphospecific antibodies and site directed mutagenesis. ^ Prohibitins have been proposed to play important roles in cancer development however the mechanism of action has not been elucidated. The second objective of this dissertation was to define the functional role of Phbs in T cell activity, survival and disease. Compared to levels in normal human T cells, Phb expression was higher in the human tumor T cell line Kit225 and subcellularly localized to the mitochondrion. Ablation of Phb expression by siRNA treatment of Kit225 cells resulted in disruption of mitochondrial membrane potential and significantly enhanced their sensitivity to cell death, suggesting they serve a protective function in T cells. Furthermore, Q-RT-PCR analysis of human oncology cDNA expression libraries indicated the Phbs may represent hematological cancer biomarkers. Indeed, Phb1 and Phb2 protein levels were 6-10 fold higher in peripheral blood mononuclear cells isolated from malignant lymphoma and multiple myeloma patients compared to healthy individuals. ^ Taken together, Phb1 and Phb2 are novel phosphoproteins upregulated during T cell activation and transformation to function in the maintenance of mitochondrial integrity and perhaps energy metabolism, thus representing previously unrecognized intracellular biomarkers and therapeutic targets for regulating T cell activation and hematologic malignancies. ^
Resumo:
Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^
Resumo:
Radiotherapy has been a method of choice in cancer treatment for a number of years. Mathematical modeling is an important tool in studying the survival behavior of any cell as well as its radiosensitivity. One particular cell under investigation is the normal T-cell, the radiosensitivity of which may be indicative to the patient's tolerance to radiation doses.^ The model derived is a compound branching process with a random initial population of T-cells that is assumed to have compound distribution. T-cells in any generation are assumed to double or die at random lengths of time. This population is assumed to undergo a random number of generations within a period of time. The model is then used to obtain an estimate for the survival probability of T-cells for the data under investigation. This estimate is derived iteratively by applying the likelihood principle. Further assessment of the validity of the model is performed by simulating a number of subjects under this model.^ This study shows that there is a great deal of variation in T-cells survival from one individual to another. These variations can be observed under normal conditions as well as under radiotherapy. The findings are in agreement with a recent study and show that genetic diversity plays a role in determining the survival of T-cells. ^
Resumo:
Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.
Resumo:
HUMAN ENDOGENOUS RETROVIRUS K AS A NOVEL TUMOR-ASSOCIATED ANTIGEN FOR DEVELOPMENT OF AN OVARIAN CANCER VACCINE Publication No.________Kiera Rycaj, B.S.Supervisory Professor: Feng Wang-Johanning, Ph.D., M.D. Ovarian cancer (OC) is the fourth most common cancer in women, and the most lethal gynecologic malignancy in the United States. Adequate screening methodologies are currently lacking and most women first present with either stage III or IV disease. To date, there has been no substantial decrease in death rates and the majorities of patients relapse and die from their disease despite response to first-line therapy. Several proteins, such as CA-125, are elevated in OC, but none has proven specific and sensitive enough to serve as a screening tool or for tumor cell recognition and lysis. It has been proposed that human endogenous retrovirus sequences (HERVs) may play a role in the etiology of certain cancers. In a previous study, we showed that HERV-K envelope (env) proteins are widely expressed in human invasive breast cancer (BC) and ductal carcinoma in situ (DCIS), and elicit both serologic and cell-mediated immune responses in BC patients. We also reported the expression of multiple HERV genes and proteins in OC cell lines and tissues. In this study, we strengthened our previous data by determining that HERV-K env mRNAs are expressed in 69% of primary OC tissues (n=29), but in only 24% of benign tissues (N=17). Immmunohistochemistry (IHC) staining revealed HERV-Kpositivecancer cells detected in endometrioid adenocarcinoma and serous adenocarcinoma but not in benign cyst or normal epithelium biopsies. Immunofluorescence staining (IFS) showed greater cell surface expression of HERV-K in OC samples compared to adjacent uninvolved samples. Enzyme-linked immunosorbent assay (ELISA) data confirmed that a humoral immune response is elicited against HERV-K in OC patients. T-cell responses against HERV-K in lymphocytes from OC patients stimulated with autologous HERV-K pulsed dendritic cells included induction of T-cell proliferation and IFN-γ production. HERV-K–specific cytolytic T cells induced greater specific lysis of OC target cells compared to benign and adjacent uninvolved target cells. Finally, upon T regulatory cell (T-reg) depletion, 64% of OC patients displayed an increase in the specific lysis of target cells expressing HERV-K env protein. These findings suggest that HERV-K env protein is a tumor-associated antigen capable of activating both T-cell and B-cell responses in OC patients, and has great potential in the development of immunotherapy regimens against OC.
Resumo:
IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE Publication No.___________ Lisa Harn-Ging Shiue, B.S. Supervisory Professor: Madeleine Duvic, M.D. Extracorporeal photopheresis (ECP) is an effective, low-risk immunomodulating therapy for leukemic cutaneous T cell lymphoma (L-CTCL) and graft versus host disease (GVHD), but whether the mechanism(s) of action in these two diseases is (are) identical or different is unclear. To determine the effects of ECP in vivo, we studied regulatory T cells (T-regs), cytotoxic T lymphocytes (CTLs), and dendritic cells (DCs) by immunofluorescence flow cytometry in 18 L-CTCL and 11 GVHD patients before and after ECP at Day 2, 1 month, 3 months, and 6 months. In this study, ECP was effective in 12/18 L-CTCL patients with a 66.7% overall response rate (ORR) and 6/11 GVHD patients with a 54.5% ORR. Prior to ECP, the percentages of CD4+Foxp3+ T cells in 9 L-CTCL patients were either lower (L-CTCL-Low, n=2) or higher (L-CTCL-High, n=7) than normal. Five of the 7 GVHD patients had high percentages of CD4+Foxp3+ T cells (GVHD-High). Six of 7 L-CTCL-High patients had >80% CD4+Foxp3+ T cells which were correlated with tumor cells, and were responders. Both L-CTCL-High and GVHD-High patients had decreased percentages of CD4+Foxp3+ and CD4+Foxp3+CD25- T cells after 3 months of treatment. CD4+Foxp3+CD25+ T cells increased in GVHD-High patients but decreased in L-CTCL-High patients after 3 months of ECP. In addition, numbers of CTLs were abnormal. We confirmed that numbers of CTLs were low in L-CTCL patients, but high in GVHD patients prior to ECP. After ECP, CTLs increased after 1 month in 4/6 L-CTCL patients whereas CTLs decreased after 6 months in 3/3 GVHD patients. Myeloid (mDCs) and plasmacytoid DCs (pDCs) were also low at baseline in L-CTCL and GVHD patients confirming the DC defect. After 6 months of ECP, numbers and percentages of mDCs and pDCs increased in L-CTCL and GVHD. MDCs were favorably increased in 8/12 L-CTCL responders whereas pDCs were favorably increased in GVHD patients. These data suggest that ECP is favorably modulating the DC subsets. In L-CTCL patients, the mDCs may orchestrate Th1 cell responses to overcome immune suppression and facilitate disease regression. However, in GVHD patients, ECP is favorably down-regulating the immune system and may be facilitating immune tolerance to auto-or allo-antigens. In both L-CTCL and GVHD patients, DCs are modulated, but the T cell responses orchestrated by the DCs are different, suggesting that ECP modulates depending on the immune milieu. _______________
Resumo:
CD8+ cytotoxic T lymphocytes (CTL) frequently infiltrate tumors, yet most melanoma patients fail to undergo tumor regression. We studied the differentiation of the CD8+ tumor-infiltrating lymphocytes (TIL) from 44 metastatic melanoma patients using known T-cell differentiation markers. We also compared CD8+ TIL against the T cells from matched melanoma patients’ peripheral blood. We discovered a novel subset of CD8+ TIL co-expressing early-differentiation markers, CD27, CD28, and a late/senescent CTL differentiation marker, CD57. This CD8+CD57+ TIL expressed a cytolytic enzyme, granzyme B (GB), yet did not express another cytolytic pore-forming molecule, perforin (Perf). In contrast, the CD8+CD57+ T cells in the periphery were CD27-CD28-, and GBHi and PerfHi. We found this TIL subset was not senescent and could be induced to proliferate and differentiate into CD27-CD57+, perforinHi, mature CTL. This further differentiation was arrested by TGF-β1, an immunosuppressive cytokine known to be produced by many different kinds of tumors. Therefore, we have identified a novel subset of incompletely differentiated CD8+ TIL that resembled those found in patients with uncontrolled chronic viral infections. In a related study, we explored prognostic biomarkers in metastatic melanoma patients treated in a Phase II Adoptive Cell Therapy (ACT) trial, in which autologous TIL were expanded ex vivo with IL-2 and infused into lymphodepleted patients. We unexpectedly found a significant positive clinical association with the infused CD8+ TIL expressing B- and T- lymphocyte attentuator (BTLA), an inhibitory T-cell receptor. We found that CD8+BTLA+ TIL had a superior proliferative response to IL-2, and were more capable of autocrine IL-2 production in response to TCR stimulation compared to the CD8+BTLA- TIL. The CD8+BTLA+ TIL were less differentiated and resembled the incompletely differentiated CD8+ TIL described above. In contrast, CD8+BTLA- TIL were poorly proliferative, expressed CD45RA and killer-cell immunoglobulin-like receptors (KIRs), and exhibited a gene expression signature of T cell deletion. Surprisingly, ligation of BTLA by its cognate receptor, HVEM, enhanced the survival of CD8+BTLA+ TIL by activating Akt/PKB. Our studies provide a comprehensive characterization of CD8+ TIL differentiation in melanoma, and revealed BTLA as a novel T-cell differentiation marker along with its role in promoting T cell survival.
Resumo:
The purpose of these studies was to determine the role of suppressor factors (TsF) in the regulation of immune responses by ultraviolet radiation-induced suppressor T lymphocytes (Ts). The Ts were induced following epicutaneous sensitization with contact allergens to an unirradiated site on mice irradiated five days earlier with 40 kJ/m$\sp2$ UVB (280-320 nm) radiation. The spleens of such mice contain afferent, hapten-specific, Thy-1$\sp+$, Lyt-1$\sp+$,2$\sp-$ Ts that suppress in vivo contact hypersensitivity (CHS) and antibody responses and the in vitro generation of cytotoxic T lymphocytes (CTL). Four approaches were used to determine the role of TsF. First, lysates produced from sonically-disrupted Ts were injected i.v. into normal animals; they inhibited CHS in vivo in a nonspecific manner. The lysates suppressed the induction and elicitation of CHS, and they inhibited the in vitro generation of CTL. Lysates prepared from splenocytes obtained from unirradiated mice or UV-irradiated, unsensitized mice failed to inhibit either response. Second, supernatants from cultures containing Ts, normal syngeneic responder lymphocytes, and hapten-modified stimulator cells were injected i.v. into normal recipients. They inhibited the induction of CHS and did so in a hapten-specific manner. Cellular and kinetic requirements were observed for the generation of suppressive activity. Splenocytes from mice treated with Ts supernatants suppressed CHS when transferred into normal animals. The supernatants also suppressed the in vitro generation of specific CTL. Third, the TsF-specific B16G monoclonal antibody was tested for its ability to modulate the effects of UV radiation in vivo. The i.v. injection of B16G into UV-irradiated mice reduced the suppression of CHS. Splenocytes of B16G-treated mice transferred into normal recipients, and they suppressed CHS, indicating that the Ts were not depleted. Fourth, B16G was used to isolate a putative TsF by antibody immunoadsorbance. When the B16G-bound fraction was eluted and injected i.v. into normal animals, it suppressed CHS and represented a 900-fold enrichment of activity over the starting material, based on specific activity. By SDS-PAGE, the B16G-bound material contained nondisulfide-linked 45- and 50-kDa components. These results suggest that TsF may play an immunoregulatory role in CHS. The isolation of a UV radiation-induced TsF lends credence to the involvement of such molecules. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^
Resumo:
A major goal of chemotherapy is to selectively kill cancer cells while minimizing toxicity to normal cells. Identifying biological differences between cancer and normal cells is essential in designing new strategies to improve therapeutic selectivity. Superoxide dismutases (SOD) are crucial antioxidant enzymes required for the elimination of superoxide (O2·− ), a free radical produced during normal cellular metabolism. Previous studies in our laboratory demonstrated that 2-methoxyestradiol (2-ME), an estradiol derivative, inhibits the function of SOD and selectively kills human leukemia cells without exhibiting significant cytotoxicity in normal lymphocytes. The present work was initiated to examine the biochemical basis for the selective anticancer activity of 2-ME. Investigations using two-parameter flow cytometric analyses and ROS scavengers established that O2·− is a primary and essential mediator of 2-ME-induced apoptosis in cancer cells. In addition, experiments using SOD overexpression vectors and SOD knockout cells found that SOD is a critical target of 2-ME. Importantly, the administration of 2-ME resulted in the selective accumulation of O 2·− and apoptosis in leukemia and ovarian cancer cells. The preferential activity of 2-ME was found to be due to increased intrinsic oxidative stress in these cancer cells versus their normal counterparts. This intrinsic oxidative stress was associated with the upregulation of the antioxidant enzymes SOD and catalase as a mechanism to cope with the increase in ROS. Furthermore, oxygen consumption experiments revealed that normal lymphocytes decrease their respiration rate in response to 2-ME-induced oxidative stress, while human leukemia cells seem to lack this regulatory mechanism. This leads to an uncontrolled production of O2·−, severe accumulation of ROS, and ultimately ROS-mediated apoptosis in leukemia cells treated with 2-ME. The biochemical differences between cancer and normal cells identified here provide a basis for the development of drug combination strategies using 2-ME with other ROS-generating agents to enhance anticancer activity. The effectiveness of such a combination strategy in killing cancer cells was demonstrated by the use of 2-ME with agents/modalities such as ionizing radiation and doxorubicin. Collectively, the data presented here strongly suggests that 2-ME may have important clinical implications for the selective killing of cancer cells. ^