972 resultados para SYNONYMOUS MUTATION


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background Mutations in the PTPN11 gene are the main cause of Noonan syndrome (NS). The presence of some NS features is a frequent finding in children with idiopathic short stature (ISS). These children can represent the milder end of the NS clinical spectrum and PTPN11 is a good candidate for involvement in the pathogenesis of ISS. Objective To evaluate the presence of mutations in PTPN11 in ISS children who presented NS-related signs and in well-characterized NS patients. Patients and methods We studied 50 ISS children who presented at least two NS-associated signs but did not fulfil the criteria for NS diagnosis. Forty-nine NS patients diagnosed by the criteria of van der Burgt et al. were used to assess the adequacy of these criteria to select patients for PTPN11 mutation screening. The coding region of PTPN11 was amplified by polymerase chain reaction (PCR), followed by direct sequencing. Results No mutations or polymorphisms were found in the coding region of the PTPN11 gene in ISS children. Nineteen of the 49 NS patients (39%) presented mutations in PTPN11. No single characteristic enabled us to distinguish between NS patients with or without PTPN11 mutations. Conclusion Considering that no mutations were found in the present cohort with NS-related signs, it is unlikely that mutations would be found in unselected ISS children. The van der Burgt et al. criteria are adequate in attaining NS diagnosis and selecting patients for molecular studies. Mutations in the PTPN11 gene are commonly involved in the pathogenesis of NS but are not a common cause of ISS.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Wolcott-Rallison syndrome (WRS, OMIM 226980) is a rare autosomal recessive disorder characterized by permanent neonatal diabetes mellitus, epiphyseal dysplasia, and other multisystemic clinical manifestations. We described two novel mutations in the EIF2AK3 gene in two consanguineous families with WRS from Brazil and Morocco. We have observed in case 1 a homozygous C > T replacement at base pair c.1192 at exon 7, generating a stop codon at position 398 (Gln398Stop). Both of his parents were found to be heterozygous for the mutation. We detected in both parents of case 2, a deceased Moroccan girl, a duplication of base pair c.851A at exon 5 (c.851dupA) leading to a frameshift and a stop codon at position 285 (p.Pro285AlafsX3). Both cases 1 and 2 had neonatal diabetes mellitus, multiple epiphyseal dysplasia, and growth delay, and presented episodes of acute hepatic dysfunction. Case 1 presented central hypothyroidism, developmental delay, and mild mental retardation. Case 2 presented a fatal episode of acute renal failure. The clinical phenotype associated with the syndrome can be variable, but a combination of infancy-onset diabetes mellitus, multiple epiphyseal dysplasia, and hepatic and/or renal dysfunction is the mainstay of diagnosis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor. (c) 2006 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Methylmalonic aciduria (MMA) and homocystinuria, cblC type (MIM 277400) is the most frequent inborn error of vitamin B-12. The recent identification of the disease gene, MMACHC, has permitted preliminary genotype-phenotype correlations. We studied 24 Italian and 17 Portuguese patients with cblC defect to illustrate the spectrum of mutations in a southern European population and discuss the impact that mutation identification has on routine diagnostic procedures. Since the metabolic defect raises the serum levels of homocysteine, we also tested if variants in MTHFR-playing a key role in homocysteine remethylation pathway-could act as genetic modifier in cblC defect. We found that the c.271 dupA (accounting for 55% of the MMA CH alleles in our cohort) followed by c.394C > T (16%) and c.331C > T (9%) were the most frequent mutations. In our study we also identified a novel mutation (c.544T > C). On the other hand, the MTHFR genotype did not appear to influence age at onset, the clinical phenotype and outcome of patients with cblC defect. This study shows that mutation screening for the most common MMACH mutations occurring in early-onset forms (c.271dupA and c.331C > T) seems to have a high diagnostic yield in a southern European population with cblC defect. Although the identification of the gene defect per se does not predict completely time and severity of disease appearance, our data corroborate the importance of a molecular testing to offer accurate prenatal diagnosis to couples at high risk of having affected children. (C) 2007 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Wilson`s disease (WD) is a rare inborn metabolic error characterized by deficient biliary copper excretion secondary to ATP7B gene mutations. Neurological presentations are variable in respect to both pattern and age of onset; commonly a movement disorder presents in the second or third decade. The aim of this study was to ascertain genotype correlations with distinct neurological manifestations in 41 WD patients in a Brazilian center for WD. A total of 23 distinct mutations were detected, and the frameshift 3402de1C had the highest allelic frequency (31.7%). An association between 3402de1C and dysphagia was detected (p = 0.01) but the limited number of patients is insufficient to allow one to draw conclusions. Both clinical studies analyzing larger cohorts and basic research on ATP7B protein function could potentially shed more light on our understanding of WD. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: The potential involvement of SRY in abnormal gonadal development in 45,X/46,X,der(Y) patients was proposed following the identification of SRY mutations in a few patients with Turner syndrome (TS). However, its exact etiological role in gonadal dysgenesis in patients with Y chromosome mosaicisms has not yet been clarified. Aims: It was the aim of this study to screen for allelic variation in SRY in a large cohort of patients with disorders of sex development due to chromosomal abnormalities with 45, X/46, X, der(Y) karyotype. Patients: Twenty-seven patients, 14 with TS and 13 with mixed gonadal dysgenesis (MGD), harboring 45, X/46, X, der(Y) karyotypes were selected. Methods: Genomic DNA was extracted from peripheral blood leukocytes of all patients and from gonadal tissue in 4 cases. The SRY coding region was PCR amplified and sequenced. Results: We identified only 1 polymorphism (c.561C -> T) in a 45,X/46,XY MGD patient, which was detected in blood and in gonadal tissue. Conclusion: Our results indicate that mutations in SRY are rare findings in patients with Y chromosome mosaicisms. Therefore, a significant role of mutated SRY in the etiology of gonadal dysgenesis in patients harboring 45, X/46, XY karyotype and variants seems very unlikely. Copyright (C) 2010 S. Karger AG, Basel

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multiple endocrine neoplasia type 2 is characterized by germline mutations in RET. For exon 10, comprehensive molecular and corresponding phenotypic data are scarce. The International RET Exon 10 Consortium, comprising 27 centers from 15 countries, analyzed patients with RET exon 10 mutations for clinical-risk profiles. Presentation, age-dependent penetrance, and stage at presentation of medullary thyroid carcinoma (MTC), pheochromocytoma, and hyperparathyroidism were studied. A total of 340 subjects from 103 families, age 4-86, were registered. There were 21 distinct single nucleotide germline mutations located in codons 609 (45 subjects), 611 (50), 618 (94), and 620 (151). MTC was present in 263 registrants, pheochromocytoma in 54, and hyperparathyroidism in 8 subjects. Of the patients with MTC, 53% were detected when asymptomatic, and among those with pheochromocytoma, 54%. Penetrance for MTC was 4% by age 10, 25% by 25, and 80% by 50. Codon-associated penetrance by age 50 ranged from 60% (codon 611) to 86% (620). More advanced stage and increasing risk of metastases correlated with mutation in codon position (609-620) near the juxtamembrane domain. Our data provide rigorous bases for timing of premorbid diagnosis and personalized treatment/prophylactic procedure decisions depending on specific RET exon 10 codons affected. Hum Mutat 32:51-58, 2011. (C) 2010 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

LRRK2 mutations can cause familial and sporadic Parkinson`s disease (PD) with Lewy-body pathology at post-mortem. Studies of olfaction in LRRK2 are sparse and incongruent. We applied a previously validated translation of the 16 item smell identification test from Sniffin` Sticks (SS-16) to 14 parkinsonian carriers of heterozygous G2019S LRRK2 mutation and compared with 106 PD patients and 118 healthy controls. The mean SS-16 score in LRRK2 was higher than in PD (p < 0.001, 95% CI for beta = -4.7 to -1.7) and lower than in controls (p = 0.007, 95% CI for beta = +0.6 to +3.6). In the LRRK2 group, subjects with low scores had significantly more dyskinesia. They also had younger age of onset, longer disease duration, and reported less frequently a family history of PD, but none of these other differences reached significance. Odor identification is diminished in LRRK2 parkinsonism but not to the same extent as in idiopathic PD. (C) 2010 Movement Disorder Society

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Context: GLI2 is a transcription factor downstream in Sonic Hedgehog signaling, acting early in ventral forebrain and pituitary development. GLI2 mutations were reported in patients with holoprosencephaly (HPE) and pituitary abnormalities. Objective: The aim was to report three novel frameshift/nonsense GLI2 mutations and the phenotypic variability in the three families. Setting: The study was conducted at a university hospital. Patients and Methods: The GLI2 coding region of patients with isolated GH deficiency (IGHD) or combined pituitary hormone deficiency was amplified by PCR using intronic primers and sequenced. Results: Three novel heterozygous GLI2 mutations were identified: c. 2362_2368del p. L788fsX794 (family 1), c. 2081_2084del p. L694fsX722 (family 2), and c. 1138 G > T p. E380X (family 3). All predict a truncated protein with loss of the C-terminal activator domain. The index case of family 1 had polydactyly, hypoglycemia, and seizures, and GH, TSH, prolactin, ACTH, LH, and FSH deficiencies. Her mother and seven relatives harboring the same mutation had polydactyly, including two uncles with IGHD and one cousin with GH, TSH, LH, and FSH deficiencies. In family 2, a boy had cryptorchidism, cleft lip and palate, and GH deficiency. In family 3, a girl had hypoglycemia, seizures, excessive thirst and polyuria, and GH, ACTH, TSH, and antidiuretic hormone deficiencies. Magnetic resonance imaging of four patients with GLI2 mutations and hypopituitarism showed a hypoplastic anterior pituitary and an ectopic posterior pituitary lobe without HPE. Conclusion: We describe three novel heterozygous frameshift or nonsense GLI2 mutations, predicting truncated proteins lacking the activator domain, associated with IGHD or combined pituitary hormone deficiency and ectopic posterior pituitary lobe without HPE. These phenotypes support partial penetrance, variable polydactyly, midline facial defects, and pituitary hormone deficiencies, including diabetes insipidus, conferred by heterozygous frameshift or nonsense GLI2 mutations. (J Clin Endocrinol Metab 95: E384-E391, 2010)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study analyzed the genotype distribution and frequency of lamivudine (LAM) and tenofovir (TDF) resistance mutations in a group of patients co-infected with HIV and hepatitis B virus (HBV). A cross-sectional study of 847 patients with HIV was conducted. Patients provided blood samples for HBsAg detection. The load of HBV was determined using an ""in-house"" real-time polymerase chain reaction. HBV genotypes/subgenotypes, antiviral resistance, basal core promoter (BCP), and precore mutations were detected by DNA sequencing. Twenty-eight patients with co-infection were identified. The distribution of HBV genotypes among these patients was A (n = 9; 50%), D (n = 4; 22.2%), G (n = 3; 16.7%), and F (n = 2; 11.1%). Eighteen patients were treated with LAM and six patients were treated with LAM plus TDF. The length of exposure to LAM and TDF varied from 4 to 216 months. LAM resistance substitutions (rtL180M + rtM204V) were detected in 10 (50%) of the 20 patients with viremia. This pattern and an accompanying rtV173L mutation was found in four patients. Three patients with the triple polymerase substitution pattern (rtV173L+ rtL180M + rtM204V) had associated changes in the envelope gene (sE164D + sl195M). Mutations in the BCP region (A1762T, G1764A) and in the precore region (G1896A, G1899A) were also found. No putative TDF resistance substitution was detected. The data suggest that prolonged LAM use is associated with the emergence of particular changes in the HBV genome, including substitutions that may elicit a vaccine escape phenotype. No putative TDF resistance change was detected after prolonged use of TDF. J. Med. Virol. 82:1481-1488, 2010. (C) 2010 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

P>Context Congenital generalized lipodystrophy, or Berardinelli-Seip syndrome, is a rare autosomal recessive disease caused by mutations in either the BSCL2 or AGPAT2 genes. This syndrome is characterized by an almost complete loss of adipose tissue usually diagnosed at birth or early infancy resulting in apparent muscle hypertrophy. Common clinical features are acanthosis nigricans, hepatomegaly with or without splenomegaly and high stature. Acromegaloid features, cardiomyopathy and mental retardation can also be present. Design We investigated 11 kindreds from different geographical areas of Brazil (northeast and southeast). All coding regions as well as flanking intronic regions of both genes were examined. Polymerase chain reaction (PCR) amplifications were performed using primers described previously and PCR products were sequenced directly. Results Four AGPAT2 and two BSCL2 families harboured the same set of mutations. BSCL2 gene mutations were found in the homozygous form in four kindreds (c.412C > T c.464T > C, c.518-519insA, IVS5-2A > G), and in two kindreds compound mutations were found (c.1363C > T, c.424A > G). In the other four families, one mutation of the AGPAT2 gene was found (IVS3-1G > C and c.299G > A). Conclusions We have demonstrated four novel mutations of the BSCL2 and AGPAT2 genes responsible for Berardinelli-Seip syndrome and Brunzell syndrome (AGPAT2-related syndrome).