994 resultados para Pregnancy, normal


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Our objective was to measure maternal plasma and amniotic fluid amino acid concentrations in pregnant women diagnosed as having fetuses with gastroschisis in the second trimester of pregnancy. Twenty-one pregnant women who had fetuses with gastroschisis detected by ultrasonography (gastroschisis group) in the second trimester and 32 women who had abnormal triple screenings indicating an increased risk for Down syndrome but had healthy fetuses (control group) were enrolled in the study. Amniotic fluid was obtained by amniocentesis, and maternal plasma samples were taken simultaneously. The chromosomal analysis of the study and control groups was normal. Levels of free amino acids and non-essential amino acids were measured in plasma and amniotic fluid samples using EZ:fast kits (EZ:fast GC/FID free (physiological) amino acid kit) by gas chromatography (Focus GC AI 3000 Thermo Finnigan analyzer). The mean levels of essential amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine) and non-essential amino acids (alanine, glycine, proline, and tyrosine) in amniotic fluid were found to be significantly higher in fetuses with gastroschisis than in the control group (P < 0.05). A significant positive correlation between maternal plasma and amniotic fluid concentrations of essential and nonessential amino acids was found only in the gastroschisis group (P < 0.05). The detection of significantly higher amino acid concentrations in the amniotic fluid of fetuses with a gastroschisis defect than in healthy fetuses suggests the occurrence of amino acid malabsorption or of amino acid leakage from the fetus into amniotic fluid.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plasma amino acid levels have never been studied in the placental intervillous space of preterm gestations. Our objective was to determine the possible relationship between plasma amino acids of maternal venous blood (M), of the placental intervillous space (PIVS) and of the umbilical vein (UV) of preterm newborn infants. Plasma amino acid levels were analyzed by ion-exchange chromatography in M from 14 parturients and in the PIVS and UV of their preterm newborn infants. Mean gestational age was 34 ± 2 weeks, weight = 1827 ± 510 g, and all newborns were considered adequate for gestational age. The mean Apgar score was 8 and 9 at the first and fifth minutes. Plasma amino acid values were significantly lower in M than in PIVS (166%), except for aminobutyric acid. On average, plasma amino acid levels were significantly higher in UV than in M (107%) and were closer to PIVS than to M values, except for cystine and aminobutyric acid (P < 0.05). Comparison of the mean plasma amino acid concentrations in the UV of preterm to those of term newborn infants previously studied by our group showed no significant difference, except for proline (P < 0.05), preterm > term. These data suggest that the mechanisms of active amino acid transport are centralized in the syncytiotrophoblast, with their passage to the fetus being an active bidirectional process with asymmetric efflux. PIVS could be a reserve amino acid space for the protection of the fetal compartment from inadequate maternal amino acid variations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The prevalence of smoking during pregnancy in Ribeirão Preto, a rich Brazilian city, was significantly higher (21.4%) than in São Luís (5.9%), a less developed city. To assess which variables explain the difference in prevalence of smoking during pregnancy, data from two birth cohorts were used, including 2846 puerperae from Ribeirão Preto, in 1994, and 2443 puerperae from São Luís, in 1997/98. In multivariable analysis, risk of maternal smoking during pregnancy was higher in São Luís for mothers living in a household with five or more persons (OR = 1.72, 95%CI = 1.12-2.64), aged 35 years or older (OR = 1.98, 95%CI = 0.99-3.96), who had five or more children (OR = 2.10, 95%CI = 1.16-3.81), and whose companion smoked (OR = 2.20, 95%CI = 1.52-3.18). Age of less than 20 years was a protective factor (OR = 0.55, 95%CI = 0.33-0.92). In Ribeirão Preto there was association with maternal low educational level (OR = 2.18, 95%CI = 1.30-3.65) and with a smoking companion (OR = 3.25, 95%CI = 2.52-4.18). Receiving prenatal care was a protective factor (OR = 0.24, 95%CI = 0.11-0.49). Mothers from Ribeirão Preto who worked outside the home were at a higher risk and those aged 35 years or older or who attended five or more prenatal care visits were at lower risk of smoking during pregnancy as compared to mothers from São Luís. Smoking by the companion reduced the difference between smoking rates in the two cities by 10%. The socioeconomic variables in the model did not explain the higher prevalence of smoking during pregnancy in the more developed city.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study aimed to investigate visceral adipose tissue-specific serpin (vaspin) concentrations in serum and term placentas and relate these values to insulin resistance and lipid parameters in women with gestational diabetes mellitus (GDM). A total of 30 GDM subjects and 27 age-matched pregnant women with normal glucose tolerance (NGT, control) were included. Serum glucose, glycated hemoglobin (HbA1c), lipid profile, insulin, and vaspin were measured at the end of pregnancy, and homeostasis model of assessment-insulin resistance (HOMA-IR) values were calculated. Vaspin mRNA and protein levels in placentas were measured by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting, respectively. Serum vaspin levels were significantly lower in the GDM group than in controls (0.49±0.24 vs 0.83±0.27 ng/mL, respectively; P<0.01). Three days after delivery, serum vaspin levels were significantly decreased in subjects with GDM (0.36±0.13 vs0.49±0.24 ng/mL, P<0.01). However, in the GDM group, serum vaspin levels were not correlated with the parameters evaluated. In contrast, in the control group, serum vaspin levels were positively correlated with triglycerides (TG; r=0.45, P=0.02) and very low-density lipoprotein cholesterol (VLDL-C; r=0.42, P=0.03). Placental mRNA vaspin (0.60±0.32 vs0.68±0.32, P=0.46) and protein (0.30±0.08 vs0.39±0.26; P=0.33) levels in the GDM group did not differ significantly from those in the control group, but were negatively correlated with neonatal birth weight in the GDM group (r=-0.48, P=0.03; r=-0.88; P<0.01). Our findings indicated that vaspin may be an important adipokine involved in carbohydrate and lipid metabolism and may also play a role in fetal development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Genetic, Prenatal and Postnatal Determinants of Weight Gain and Obesity in Young Children – The STEPS Study University of Turku, Faculty of Medicine, Department of Paediatrics, University of Turku Doctoral Program of Clinical Investigation (CLIPD), Turku Institute for Child and Youth Research. Conditions of being overweight and obese in childhood are common health problems with longlasting effects into adulthood. Currently 22% of Finnish boys and 12% of Finnish girls are overweight and 4% of Finnish boys and 2% of Finnish girls are obese. The foundation for later health is formed early, even before birth, and the importance of prenatal growth on later health outcomes is widely acknowledged. When the mother is overweight, had high gestational weight gain and disturbances in glucose metabolism during pregnancy, an increased risk of obesity in children is present. On the other hand, breastfeeding and later introduction of complementary foods are associated with a decreased obesity risk. In addition to these, many genetic and environmental factors have an effect on obesity risk, but the clustering of these factors is not extensively studied. The main objective of this thesis was to provide comprehensive information on prenatal and early postnatal factors associated with weight gain and obesity in infancy up to two years of age. The study was part of the STEPS Study (Steps to Healthy Development), which is a follow-up study consisting of 1797 families. This thesis focused on children up to 24 months of age. Altogether 26% of boys and 17% of girls were overweight and 5% of boys and 4% of girls were obese at 24 months of age according to New Finnish Growth references for Children BMI-for-age criteria. Compared to children who remained normal weight, the children who became overweight or obese showed different growth trajectories already at 13 months of age. The mother being overweight had an impact on children’s birth weight and early growth from birth to 24 months of age. The mean duration of breastfeeding was almost 2 months shorter in overweight women in comparison to normal weight women. A longer duration of breastfeeding was protective against excessive weight gain, high BMI, high body weight and high weight-for-length SDS during the first 24 months of life. Breast milk fatty acid composition differed between overweight and normal weight mothers, and overweight women had more saturated fatty acids and less n-3 fatty acids in breast milk. Overweight women also introduced complementary foods to their infants earlier than normal weight mothers. Genetic risk score calculated from 83 obesogenic- and adiposity-related single nucleotide polymorphisms (SNPs) showed that infants with a high genetic risk for being overweight and obese were heavier at 13 months and 24 months of age than infants with a low genetic risk, thus possibly predisposing to later obesity in obesogenic environment. Obesity Risk Score showed that children with highest number of risk factors had almost 6-fold risk of being overweight and obese at 24 months compared to children with lowest number of risk factors. The accuracy of the Obesity Risk Score in predicting overweight and obesity at 24 months was 82%. This study showed that many of the obesogenic risk factors tend to cluster within children and families and that children who later became overweight or obese show different growth trajectories already at a young age. These results highlight the importance of early detection of children with higher obesity risk as well as the importance of prevention measures focused on parents. Keywords: Breastfeeding, Child, Complementary Feeding, Genes, Glucose metabolism, Growth, Infant Nutrition Physiology, Nutrition, Obesity, Overweight, Programming

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.