990 resultados para Perry, Matthew Calbraith,


Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The analysis of organic residues from pottery sherds using Gas-Chromatography with mass-spectroscopy (GC-MS) has revealed information about the variety of foods eaten and domestic routine at Silchester between the second and fourth–sixth centuries A.D. Two results are discussed in detail: those of a second-century Gauloise-type amphora and a fourth-century SE Dorset black-burnished ware (BB1) cooking pot, which reveal the use of pine pitch on the inner surface of the amphora and the use of animal fats (ruminant adipose fats) and leafy vegetables in cooking at the Roman town of Silchester, Hants.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

External reflection FTIR spectroscopy and surface pressure measurements were used to compare conformational changes in the adsorbed structures of three globular proteins at the air/water interface. Of the three proteins studied, lysozyme, bovine serum albumin and P-lactoglobulin, lysozyme was unique in its behaviour. Lysozyme adsorption was slow, taking approximately 2.5 h to reach a surface pressure plateau (from a 0.07 mM solution), and led to significant structural change. The FTIR spectra revealed that lysozyme formed a highly networked adsorbed layer of unfolded protein with high antiparallel beta-sheet content and that these changes occurred rapidly (within 10 min). This non-native secondary structure is analogous to that of a 3D heat-set protein gel, suggesting that the adsorbed protein formed a highly networked interfacial layer. Albumin and P-lactoglobulin adsorbed rapidly (reaching a plateau within 10 min) and with little chance to their native secondary structure.

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A 2,500 word article on the subject of euergetism in the ancient Greek and Roman world in a major international encyclopaedia of political theory.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The collection efficiency of two widely used gunshot residue (GSR) collection techniques—carbon-coated adhesive stubs and alcohol swabs—has been compared by counting the number of characteristic GSR particles collected from the firing hand of a shooter after firing one round. Samples were analyzed with both scanning electron microscopy and energy dispersive X-rays by an experienced GSR analyst, and the number of particles on each sample containing Pb, Ba, and Sb counted. The adhesive stubs showed a greater collection efficiency as all 24 samples gave positive results for GSR particles whereas the swabs gave only positive results for half of the 24 samples. Results showed a statistically significant collection efficiency for the stub collection method and likely reasons for this are considered.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article provides a brief critique of a recent article on biomineralisation and preservation. It gives a summary of the difference between biomineralisation and mineral replacement, and addresses problems with the interpretation of FT-IR data. The lack of contextual information for the samples studied is another problem which is highlighted.

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Climate change is expected to produce reductions in water availability in England, potentially necessitating adaptive action by the water industry to maintain supplies. As part of Ofwat's fifth Periodic Review (PR09), water companies recently released their draft Water Resources Management Plans, setting out how each company intends to maintain the balance between the supply and demand for water over the next 25 years, following Environment Agency guidelines. This paper reviews these plans to determine company estimates of the impact of climate change on water supply relative to other resource pressures. The approaches adopted for incorporating the impact in the plans and the proposed management solutions are also identified. Climate change impacts for individual resource zones range from no reductions in deployable output to greater than 50% over the planning period. The estimated national aggregated loss of deployable output under a “core” climate scenario is ~520 Ml/d (3% of deployable output) by 2034/35, the equivalent of the supply of one entire water company (South West Water). Climate change is the largest single driver of change in water supplies over the planning period. Over half of the climate change impact is concentrated in southern England. In extreme cases, climate change uncertainty is of the same magnitude as the change under the core scenario (up to a loss of ~475 Ml/d). 44 of the 68 resource zones with available data are estimated to have a climate change impact. In 35 of these climate change has the greatest impact although in 10 zones sustainability reductions have a greater impact. Of the overall change in downward pressure on the supply-demand balance over the planning period, ~56% is accounted for by increased demand (620 Ml/d) and supply side climate change accounts for ~37% (407 Ml/d). Climate change impacts have a cumulative impact in concert with other changing supply side reducing components increasing the national pressure on the supply-demand balance. Whilst the magnitude of climate change appears to justify its explicit consideration, it is rare that adaptation options are planned solely in response to climate change but as a suite of options to provide a resilient supply to a range of pressures (including significant demand side pressures). Supply-side measures still tend to be considered by water companies to be more reliable than demand-side measures.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper presents preliminary results from an assessment of the barriers to adaptation to water supply shortage in a case study catchment in south east England with multiple supply companies. The investigation applies a conceptual framework, which distinguishes between generic barriers affecting the ability of supply companies to make adaptation decisions, and specific barriers to the implementation of each option. The preliminary analysis suggests that whilst there is a widespread awareness of the challenge of climate change, and a conceptual understanding of the need for adaptation, some of the generic barriers that will affect detailed evaluations and actual adaptation decisions have yet to be approached. The analysis also shows that different individual adaptation options are assessed differently by different stakeholders, and that there are differences in the barriers to adoption between supply-side and demand-side measures. First, however, the paper develops the general conceptual framework for the characterisation of the barriers to adaptation used in the study.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The discovery of polymers with stimuli responsive physical properties is a rapidly expanding area of research. At the forefront of the field are self-healing polymers, which, when fractured can regain the mechanical properties of the material either autonomically, or in response to a stimulus. It has long been known that it is possible to promote healing in conventional thermoplastics by heating the fracture zone above the Tg of the polymer under pressure. This process requires reptation and subsequent re-entanglement of macromolecules across the fracture void, which serves to bridge, and ‘heal’ the crack. The timescale for this mechanism is highly dependent on the molecular weight of the polymer being studied. This process is in contrast to that required to affect healing in supramolecular polymers such as the plasticised, hydrogen bonded elastomer reported by Leibler et al. The disparity in bond energies between the non-covalent and covalent bonds within supramolecular polymers results in fractures propagating through scission of the comparatively weak supramolecular interactions, rather than through breaking the stronger, covalent bonds. Thus, during the healing process the macromolecules surrounding the fracture site only need sufficient energy to re-engage their supramolecular interactions in order to regenerate the strength of the pristine material. Herein we describe the design, synthesis and optimization of a new class of supramolecular polymer blends that harness the reversible nature of pi-pi stacking and hydrogen bonding interactions to produce self-supporting films with facile healable characteristics.