Effect of the human leukocyte antigen HLA-DRB1 and anti-cyclic citrullinated peptide on the outcome of rheumatoid arthritis patients

Our objective was to determine whether the presence of the human leukocyte antigen HLA-DRB1 locus is associated with production of anti-cyclic citrullinated peptide antibodies (anti-CCP Abs) and to what extent they are associated with increased susceptibility to and severity of rheumatoid arthritis (RA) in Egyptian patients. Twenty-nine RA patients gave informed consent to participate in a case-control study that was approved by the Ain Shams University Medical Ethics Committee. RA disease activity and severity were determined using the simplified disease activity index and Larsen scores, respectively. We used a wide scale national study on the pattern of HLA typing in normal Egyptians as a control study. Anti-CCP Abs and HLA-DRB1 typing were determined for all subjects. The alleles most strongly associated with RA were HLA-DRB1 [*01 , *04 and *06] (41.4%). RA patients with serum anti-CCP Ab titers above 60 U/mL had a significantly higher frequency of HLA-DRB1*01 (58.3%) and HLA-DRB1*04 alleles (83.3%). Significant positive correlations were found between serum and synovial anti-CCP Ab titer, RA disease activity, and severity (r = 0.87, 0.66 and 0.63, respectively; P < 0.05). HLA-DRB1 SE+ alleles [*01 and *04] were highly expressed among Egyptian RA patients. The presence of these alleles was associated with higher anti-CCP Ab titer, active and severe RA disease. Early determination of HLA-DRB1 SE+ alleles and serum anti-CCP Ab could facilitate the prediction of the clinical course and prognosis of RA when first evaluated leading to better disease control.

Normal range values for thromboelastography in healthy adult volunteers

Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

The role of micro-ribonucleic acids in normal hematopoiesis and leukemic T-lymphogenesis

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Can course format influence the performance of students in an advanced cardiac life support (ACLS) program?

Advanced cardiac life support (ACLS) is a problem-based course that employs simulation techniques to teach the standard management techniques of cardiovascular emergencies. Its structure is periodically revised according to new versions of the American Heart Association guidelines. Since it was introduced in Brazil in 1996, the ACLS has been through two conceptual and structural changes. Detailed documented reports on the effect of these changes on student performance are limited. The objective of the present study was to evaluate the effect of conceptual and structural changes of the course on student ACLS performance at a Brazilian training center. This was a retrospective study of 3266 students divided into two groups according to the teaching model: Model 1 (N = 1181; 1999-2003) and Model 2 (N = 2085; 2003-2007). Model 2 increased practical skill activities to 75% of the total versus 60% in Model 1. Furthermore, the teaching material provided to the students before the course was more objective than that used for Model 1. Scores greater than 85% in the theoretical evaluation and approval in the evaluation of practice by the instructor were considered to be a positive outcome. Multiple logistic regression was used to adjust for potential confounders (specialty, residency, study time, opportunity to enhance practical skills during the course and location where the course was given). Compared to Model 1, Model 2 presented odds ratios (OR) indicating better performance in the theoretical (OR = 1.34; 95%CI = 1.10-1.64), practical (OR = 1.19; 95%CI = 0.90-1.57), and combined (OR = 1.38; 95%CI = 1.13-1.68) outcomes. Increasing the time devoted to practical skills did not improve the performance of ACLS students.

Leptin and adiponectin in the female life course

Adipose tissue secretes a variety of adipokines, including leptin and adiponectin, which are involved in endocrine processes regulating glucose and fatty metabolism, energy expenditure, inflammatory response, immunity, cardiovascular function, and reproduction. The present article describes the fluctuations in circulating leptin and adiponectin as well as their patterns of secretion in women from birth to menopause. During pregnancy, leptin and adiponectin seem to act in an autocrine/paracrine fashion in the placenta and adipose tissue, playing a role in the maternal-fetal interface and contributing to glucose metabolism and fetal development. In newborns, adiponectin levels are two to three times higher than in adults. Full-term newborns have significantly higher leptin and adiponectin levels than preterms, whereas small-for-gestational-age infants have lower levels of these adipokines than adequate-for-gestational-age newborns. However, with weight gain, leptin concentrations increase significantly. Children between 5 and 8 years of age experience an increase in leptin and a decrease in adiponectin regardless of body mass index, with a reversal of the newborn pattern for adiponectin: plasma adiponectin levels at age five are inversely correlated with percentage of body fat. In puberty, leptin plays a role in the regulation of menstrual cycles. In adults, it has been suggested that obese individuals exhibit both leptin resistance and decreased serum adiponectin levels. In conclusion, a progressive increase in adiposity throughout life seems to influence the relationship between leptin and adiponectin in women.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Time course of the hemodynamic responses to aortic depressor nerve stimulation in conscious spontaneously hypertensive rats

The time to reach the maximum response of arterial pressure, heart rate and vascular resistance (hindquarter and mesenteric) was measured in conscious male spontaneously hypertensive (SHR) and normotensive control rats (NCR; Wistar; 18-22 weeks) subjected to electrical stimulation of the aortic depressor nerve (ADN) under thiopental anesthesia. The parameters of stimulation were 1 mA intensity and 2 ms pulse length applied for 5 s, using frequencies of 10, 30, and 90 Hz. The time to reach the hemodynamic responses at different frequencies of ADN stimulation was similar for SHR (N = 15) and NCR (N = 14); hypotension = NCR (4194 ± 336 to 3695 ± 463 ms) vs SHR (3475 ± 354 to 4494 ± 300 ms); bradycardia = NCR (1618 ± 152 to 1358 ± 185 ms) vs SHR (1911 ± 323 to 1852 ± 431 ms), and the fall in hindquarter vascular resistance = NCR (6054 ± 486 to 6550 ± 847 ms) vs SHR (4849 ± 918 to 4926 ± 646 ms); mesenteric = NCR (5574 ± 790 to 5752 ± 539 ms) vs SHR (5638 ± 648 to 6777 ± 624 ms). In addition, ADN stimulation produced baroreflex responses characterized by a faster cardiac effect followed by a vascular effect, which together contributed to the decrease in arterial pressure. Therefore, the results indicate that there is no alteration in the conduction of the electrical impulse after the site of baroreceptor mechanical transduction in the baroreflex pathway (central and/or efferent) in conscious SHR compared to NCR.

Interleukin-10-dependent down-regulation of interferon-gamma response to Leishmania by Mycobacterium leprae antigens during the clinical course of a coinfection

We have described a case of a patient with an intriguing association of mucocutaneous leishmaniasis with lepromatous leprosy, two opposite polar forms of these spectral diseases. In the present follow-up study, we investigated the effect of the addition of Mycobacterium leprae antigens on interferon-gamma (IFN-γ) production in Leishmania antigen-stimulated cultures of peripheral blood mononuclear cells (PBMC) from this patient. For this purpose, PBMC cultures were stimulated with crude L. braziliensis and/or M. leprae whole-cell antigen extracts or with concanavalin A. In some experiments, neutralizing anti-human interleukin (IL)-10 antibodies were added to the cultures. IFN-γ and IL-10 levels in culture supernatants were measured by ELISA. During active leprosy, M. leprae antigens induced 72.3% suppression of the IFN-γ response to L. braziliensis antigen, and this suppression was abolished by IL-10 neutralization. Interestingly, the suppressive effect of M. leprae antigen was lost after the cure of leprosy and the disappearance of this effect was accompanied by exacerbation of mucosal leishmaniasis. Considered together, these results provide evidence that the concomitant lepromatous leprosy induced an IL-10-mediated regulatory response that controlled the immunopathology of mucosal leishmaniasis, demonstrating that, in the context of this coinfection, the specific immune response to one pathogen can influence the immune response to the other pathogen and the clinical course of the disease caused by it. Our findings may contribute to a better understanding of the Leishmania/M. leprae coinfection and of the immunopathogenesis of mucosal leishmaniasis.

Exogenous normal lymph alleviates microcirculation disturbances and abnormal hemorheological properties in rats with disseminated intravascular coagulation

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Exogenous normal lymph reduces liver injury induced by lipopolysaccharides in rats

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Successful domino liver transplantation in maple syrup urine disease using a related living donor

Maple syrup urine disease (MSUD) is an autosomal recessive disease associated with high levels of branched-chain amino acids. Children with MSUD can present severe neurological damage, but liver transplantation (LT) allows the patient to resume a normal diet and avoid further neurological damage. The use of living related donors has been controversial because parents are obligatory heterozygotes. We report a case of a 2-year-old child with MSUD who underwent a living donor LT. The donor was the patient's mother, and his liver was then used as a domino graft. The postoperative course was uneventful in all three subjects. DNA analysis performed after the transplantation (sequencing of the coding regions of BCKDHA, BCKDHB, andDBT genes) showed that the MSUD patient was heterozygous for a pathogenic mutation in the BCKDHB gene. This mutation was not found in his mother, who is an obligatory carrier for MSUD according to the family history and, as expected, presented both normal clinical phenotype and levels of branched-chain amino acids. In conclusion, our data suggest that the use of a related donor in LT for MSUD was effective, and the liver of the MSUD patient was successfully used in domino transplantation. Routine donor genotyping may not be feasible, because the test is not widely available, and, most importantly, the disease is associated with both the presence of allelic and locus heterogeneity. Further studies with this population of patients are required to expand the use of related donors in MSUD.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Time-course effects of aerobic exercise training on cardiovascular and renal parameters in 2K1C renovascular hypertensive rats

Exercise training (Ex) has been recommended for its beneficial effects in hypertensive states. The present study evaluated the time-course effects of Ex without workload on mean arterial pressure (MAP), reflex bradycardia, cardiac and renal histology, and oxidative stress in two-kidney, one-clip (2K1C) hypertensive rats. Male Fischer rats (10 weeks old; 150–180 g) underwent surgery (2K1C or SHAM) and were subsequently divided into a sedentary (SED) group and Ex group (swimming 1 h/day, 5 days/week for 2, 4, 6, 8, or 10 weeks). Until week 4, Ex decreased MAP, increased reflex bradycardia, prevented concentric hypertrophy, reduced collagen deposition in the myocardium and kidneys, decreased the level of thiobarbituric acid-reactive substances (TBARS) in the left ventricle, and increased the catalase (CAT) activity in the left ventricle and both kidneys. From week 6 to week 10, however, MAP and reflex bradycardia in 2K1C Ex rats became similar to those in 2K1C SED rats. Ex effectively reduced heart rate and prevented collagen deposition in the heart and both kidneys up to week 10, and restored the level of TBARS in the left ventricle and clipped kidney and the CAT activity in both kidneys until week 8. Ex without workload for 10 weeks in 2K1C rats provided distinct beneficial effects. The early effects of Ex on cardiovascular function included reversing MAP and reflex bradycardia. The later effects of Ex included preventing structural alterations in the heart and kidney by decreasing oxidative stress and reducing injuries in these organs during hypertension.

Effects of disturbed blood flow during exercise on endothelial function: a time course analysis

This study aimed to examine the time course of endothelial function after a single handgrip exercise session combined with blood flow restriction in healthy young men. Nine participants (28±5.8 years) completed a single session of bilateral dynamic handgrip exercise (20 min with 60% of the maximum voluntary contraction). To induce blood flow restriction, a cuff was placed 2 cm below the antecubital fossa in the experimental arm. This cuff was inflated to 80 mmHg before initiation of exercise and maintained through the duration of the protocol. The experimental arm and control arm were randomly selected for all subjects. Brachial artery flow-mediated dilation (FMD) and blood flow velocity profiles were assessed using Doppler ultrasonography before initiation of the exercise, and at 15 and 60 min after its cessation. Blood flow velocity profiles were also assessed during exercise. There was a significant increase in FMD 15 min after exercise in the control arm compared with before exercise (64.09%±16.59%, P=0.001), but there was no change in the experimental arm (-12.48%±12.64%, P=0.252). FMD values at 15 min post-exercise were significantly higher for the control arm in comparison to the experimental arm (P=0.004). FMD returned to near baseline values at 60 min after exercise, with no significant difference between arms (P=0.424). A single handgrip exercise bout provoked an acute increase in FMD 15 min after exercise, returning to near baseline values at 60 min. This response was blunted by the addition of an inflated pneumatic cuff to the exercising arm.

Estrutura dos grânulos de amido de milho normal e ceroso

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.