Determination of low tetanus or diphtheria antitoxin titers in sera by a toxin neutralization assay and a modified toxin-binding inhibition test

A method for the screening of tetanus and diphtheria antibodies in serum using anatoxin (inactivated toxin) instead of toxin was developed as an alternative to the in vivo toxin neutralization assay based on the toxin-binding inhibition test (TOBI test). In this study, the serum titers (values between 1.0 and 19.5 IU) measured by a modified TOBI test (Modi-TOBI test) and toxin neutralization assays were correlated (P < 0.0001). Titers of tetanus or diphtheria antibodies were evaluated in serum samples from guinea pigs immunized with tetanus toxoid, diphtheria-tetanus or triple vaccine. For the Modi-TOBI test, after blocking the microtiter plates, standard tetanus or diphtheria antitoxin and different concentrations of guinea pig sera were incubated with the respective anatoxin. Twelve hours later, these samples were transferred to a plate previously coated with tetanus or diphtheria antitoxin to bind the remaining anatoxin. The anatoxin was then detected using a peroxidase-labeled tetanus or diphtheria antitoxin. Serum titers were calculated using a linear regression plot of the results for the corresponding standard antitoxin. For the toxin neutralization assay, L+/10/50 doses of either toxin combined with different concentrations of serum samples were inoculated into mice for anti-tetanus detection, or in guinea pigs for anti-diphtheria detection. Both assays were suitable for determining wide ranges of antitoxin levels. The linear regression plots showed high correlation coefficients for tetanus (r² = 0.95, P < 0.0001) and for diphtheria (r² = 0.93, P < 0.0001) between the in vitro and the in vivo assays. The standardized method is appropriate for evaluating titers of neutralizing antibodies, thus permitting the in vitro control of serum antitoxin levels.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Modulation of ROS production in human leukocytes by ganglioside micelles

Recent studies have reported that exogenous gangliosides, the sialic acid-containing glycosphingolipids, are able to modulate many cellular functions. We examined the effect of micelles of mono- and trisialoganglioside GM1 and GT1b on the production of reactive oxygen species by stimulated human polymorphonuclear neutrophils using different spectroscopic methods. The results indicated that exogenous gangliosides did not influence extracellular superoxide anion (O2.-) generation by polymorphonuclear neutrophils activated by receptor-dependent formyl-methionyl-leucyl-phenylalanine. However, when neutrophils were stimulated by receptor-bypassing phorbol 12-myristate 13-acetate (PMA), gangliosides above their critical micellar concentrations prolonged the lag time preceding the production in a concentration-dependent way, without affecting total extracellular O2.- generation detected by superoxide dismutase-inhibitable cytochrome c reduction. The effect of ganglioside GT1b (100 µM) on the increase in lag time was shown to be significant by means of both superoxide dismutase-inhibitable cytochrome c reduction assay and electron paramagnetic resonance spectroscopy (P < 0.0001 and P < 0.005, respectively). The observed phenomena can be attributed to the ability of ganglioside micelles attached to the cell surface to slow down PMA uptake, thus increasing the diffusion barrier and consequently delaying membrane events responsible for PMA-stimulated O2.- production.

The modified 2VO ischemia protocol causes cognitive impairment similar to that induced by the standard method, but with a better survival rate

Permanent bilateral occlusion of the common carotid arteries (2VO) in the rat has been established as a valid experimental model to investigate the effects of chronic cerebral hypoperfusion on cognitive function and neurodegenerative processes. Our aim was to compare the cognitive and morphological outcomes following the standard 2VO procedure, in which there is concomitant artery ligation, with those of a modified protocol, with a 1-week interval between artery occlusions to avoid an abrupt reduction of cerebral blood flow, as assessed by animal performance in the water maze and damage extension to the hippocampus and striatum. Male Wistar rats (N = 47) aged 3 months were subjected to chronic hypoperfusion by permanent bilateral ligation of the common carotid arteries using either the standard or the modified protocol, with the right carotid being the first to be occluded. Three months after the surgical procedure, rat performance in the water maze was assessed to investigate long-term effects on spatial learning and memory and their brains were processed in order to estimate hippocampal volume and striatal area. Both groups of hypoperfused rats showed deficits in reference (F(8,172) = 7.0951, P < 0.00001) and working spatial memory [2nd (F(2,44) = 7.6884, P < 0.001), 3rd (F(2,44) = 21.481, P < 0.00001) and 4th trials (F(2,44) = 28.620, P < 0.0001)]; however, no evidence of tissue atrophy was found in the brain structures studied. Despite similar behavioral and morphological outcomes, the rats submitted to the modified protocol showed a significant increase in survival rate, during the 3 months of the experiment (P < 0.02).

Nitric oxide synthesis and biological functions of nitric oxide released from ruthenium compounds

During three decades, an enormous number of studies have demonstrated the critical role of nitric oxide (NO) as a second messenger engaged in the activation of many systems including vascular smooth muscle relaxation. The underlying cellular mechanisms involved in vasodilatation are essentially due to soluble guanylyl-cyclase (sGC) modulation in the cytoplasm of vascular smooth cells. sGC activation culminates in cyclic GMP (cGMP) production, which in turn leads to protein kinase G (PKG) activation. NO binds to the sGC heme moiety, thereby activating this enzyme. Activation of the NO-sGC-cGMP-PKG pathway entails Ca2+ signaling reduction and vasodilatation. Endothelium dysfunction leads to decreased production or bioavailability of endogenous NO that could contribute to vascular diseases. Nitrosyl ruthenium complexes have been studied as a new class of NO donors with potential therapeutic use in order to supply the NO deficiency. In this context, this article shall provide a brief review of the effects exerted by the NO that is enzymatically produced via endothelial NO-synthase (eNOS) activation and by the NO released from NO donor compounds in the vascular smooth muscle cells on both conduit and resistance arteries, as well as veins. In addition, the involvement of the nitrite molecule as an endogenous NO reservoir engaged in vasodilatation will be described.

Silencing HIF-1α reduces the adhesion and secretion functions of acute leukemia hBMSCs

Hypoxia inducible factor-1α (HIF-1α) is an important transcription factor, which plays a critical role in the formation of solid tumor and its microenviroment. The objective of the present study was to evaluate the expression and function of HIF-1α in human leukemia bone marrow stromal cells (BMSCs) and to identify the downstream targets of HIF-1α. HIF-1α expression was detected at both the RNA and protein levels using real-time PCR and immunohistochemistry, respectively. Vascular endothelial growth factor (VEGF) and stromal cell-derived factor-1α (SDF-1α) were detected in stromal cells by enzyme-linked immunosorbent assay. HIF-1α was blocked by constructing the lentiviral RNAi vector system and infecting the BMSCs. The Jurkat cell/BMSC co-cultured system was constructed by putting the two cells into the same suitable cultured media and conditions. Cell adhesion and secretion functions of stromal cells were evaluated after transfection with the lentiviral RNAi vector of HIF-1α. Increased HIF-1α mRNA and protein was detected in the nucleus of the acute myeloblastic and acute lymphoblastic leukemia compared with normal BMSCs. The lentiviral RANi vector for HIF-1α was successfully constructed and was applied to block the expression of HIF-1α. When HIF-1α of BMSCs was blocked, the expression of VEGF and SDF-1 secreted by stromal cells were decreased. When HIF-1α was blocked, the co-cultured Jurkat cell’s adhesion and migration functions were also decreased. Taken together, these results suggest that HIF-1α acts as an important transcription factor and can significantly affect the secretion and adhesion functions of leukemia BMSCs.

Application of a modified sequential organ failure assessment score to critically ill patients

The purpose of the present study was to explore the usefulness of the Mexican sequential organ failure assessment (MEXSOFA) score for assessing the risk of mortality for critically ill patients in the ICU. A total of 232 consecutive patients admitted to an ICU were included in the study. The MEXSOFA was calculated using the original SOFA scoring system with two modifications: the PaO2/FiO2 ratio was replaced with the SpO2/FiO2 ratio, and the evaluation of neurologic dysfunction was excluded. The ICU mortality rate was 20.2%. Patients with an initial MEXSOFA score of 9 points or less calculated during the first 24 h after admission to the ICU had a mortality rate of 14.8%, while those with an initial MEXSOFA score of 10 points or more had a mortality rate of 40%. The MEXSOFA score at 48 h was also associated with mortality: patients with a score of 9 points or less had a mortality rate of 14.1%, while those with a score of 10 points or more had a mortality rate of 50%. In a multivariate analysis, only the MEXSOFA score at 48 h was an independent predictor for in-ICU death with an OR = 1.35 (95%CI = 1.14-1.59, P < 0.001). The SOFA and MEXSOFA scores calculated 24 h after admission to the ICU demonstrated a good level of discrimination for predicting the in-ICU mortality risk in critically ill patients. The MEXSOFA score at 48 h was an independent predictor of death; with each 1-point increase, the odds of death increased by 35%.

Acute effect of alcohol intake on sine-wave Cartesian and polar contrast sensitivity functions

The aim of this study was to assess contrast sensitivity for angular frequency stimuli as well as for sine-wave gratings in adults under the effect of acute ingestion of alcohol. We measured the contrast sensitivity function (CSF) for gratings of 0.25, 1.25, 2.5, 4, 10, and 20 cycles per degree of visual angle (cpd) as well as for angular frequency stimuli of 1, 2, 4, 24, 48, and 96 cycles/360°. Twenty adults free of ocular diseases, with normal or corrected-to-normal visual acuity, and no history of alcoholism were enrolled in two experimental groups: 1) no alcohol intake (control group) and 2) alcohol ingestion (experimental group). The average concentration of alcohol in the experimental group was set to about 0.08%. We used a paradigm involving a forced-choice method. Maximum sensitivity to contrast for sine-wave gratings in the two groups occurred at 4 cpd sine-wave gratings and at 24 and 48 cycles/360° for angular frequency stimuli. Significant changes in contrast sensitivity were observed after alcohol intake compared with the control condition at spatial frequency of 4 cpd and 1, 24, and 48 cycles/360° for angular frequency stimuli. Alcohol intake seems to affect the processing of sine-wave gratings at maximum sensitivity and at the low and high frequency ends for angular frequency stimuli, both under photopic luminance conditions.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Pre-treatment of thermoduric spores in CO2 modified atmosphere and their survivability during food extrusion

The aim of this experiment was to evaluate how susceptible spores become to mechanical damage during food extrusion after being submitted to CO2. B. stearothermophilus spores sowed to corn and soy mix were submitted to 99% CO2 for 10 days and extruded in a single-screw extruder. The treatments were: T1 - spore-containing samples, extruded at screw rotational speed of 65 rpm and barrel wall temperature of 80 °C; T2 - as T1, except for screw rotational speed of 150 rpm; and T3 - as T2, except that samples were submitted to the modified atmosphere. The results for cell viability, minimum and maximum residence times, and static pressure were T1 - 19.90 ± 3.24%, 123.3 ± 14.50 seconds; 203.3 ± 14.05 seconds; 2.217 ± 62 kPa; T2 - 21.42 ± 8.24%, 70.00 ± 5.77 seconds; 170.00 ± 4.67 seconds; 2.310 ± 107 kPa; and T3 - 11.06 ± 2.46%, 86.00 ± 7.23 seconds; 186.00 ± 7.50 seconds; 2.403 ± 93 kPa, respectively. It was concluded that the extrusion process did reduce the cell count. However, screw rotational speed variation or CO2 pre-treatment did not affect cell viability.

Modified broken rice starch as fat substitute in sausages

The demand for low-fat beef products has led the food industry to use fat substitutes such as modified starch. About 14% of broken rice is generated during processing. Nevertheless, this by-product contains high levels of starch; being therefore, great raw material for fat substitution. This study evaluated the applicability of chemically and physically modified broken rice starch as fat substitute in sausages. Extruded and phosphorylated broken rice was used in low-fat sausage formulation. All low-fat sausages presented about 55% reduction in the fat content and around 28% reduction in the total caloric value. Fat replacement with phosphorylated and extruded broken rice starch increased the texture acceptability of low-fat sausages, when compared to low-fat sausages with no modified broken rice. Results suggest that modified broken rice can be used as fat substitute in sausage formulations, yielding lower caloric value products with acceptable sensory characteristics.

Consumer preferences of genetically modified foods of vegetal and animal origin in Chile

Given the debate generated by Genetically Modified (GM) foods in developed and developing countries, the aim was to evaluate the importance of determining factors in the preference of consumers in Temuco and Talca in central-southern Chile for GM foods using conjoint analysis and to determine the existence of different market segments using a survey of 800 people. Using conjoint analysis, it was established that, in general, genetic modification was a more important factor than either brand or price in the consumer's decision to purchase either food. Cluster analysis identified three segments: the largest (51.4%) assigned greatest importance to brand and preferred genetically modified milk and tomato sauce; the second group (41.0%) gave greatest importance to the existence of genetic manipulation and preferred non-genetically modified foods; the smallest segment (7.6%) mainly valued price and preferred milk and tomato sauce with no genetic manipulation. The three segments rejected the store brand and preferred to pay less for both foods. The results are discussed based on studies conducted in developed and developing countries.

Effect of modified clays on the structure and functional properties of biofilms produced with zein

The purpose of this study was to evaluate changes in the structure and some functional properties of biofilms added with modified clays (Cloisite® 15A and Cloisite® 30B) prepared by the casting method. The analysis of the microstructure of the films, scanning electron microscopy (SEM), Optical microscopy (MO), and Infrared Spectroscopy (FTIR) indicated that the addition of clay in the films resulted in the formation of a heterogeneous microstructure, microcomposite or tactoid. Due to the formation of a microcomposite structure, functional properties of the films added with both clays such as opacity, solubility, and permeability to water vapor (PVA), were not better than those of the control film. Thus, it was concluded that although it is possible to produce a film added with modified clays using the casting method, it was not possible to obtain intercalation or exfoliation in a nanocomposite, which would result in improved functional properties.