999 resultados para Microscopic agglutination test
Resumo:
In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.
Resumo:
Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.
Resumo:
The aim of this study was to evaluate the tissue compatibility of a silorane-based resin system (FiltekTM Silorane) and a methacrylatebased nanoparticle resin (FiltekTM Supreme XT) after implantation in the subcutaneous connective tissue of isogenic mice. One hundred and thirty five male isogenic BALB/c mice were randomly assigned to 12 experimental and 3 control groups, according to the implanted material and the experimental period of 7, 21 and 63 days. At the end of each period, the animals were killed and the tubes with the surrounding tissues were removed and processed for microscopic analysis. Samples were subjected to a descriptive and a semi-quantitative analyses using a 4-point scoring system (0-3) to evaluate the collagen fiber formation and inflammatory infiltrate. Data were statistically analyzed using the Kruskal Wallis test (a=0.05). The results showed that there was no significant difference between the experimental and control groups considering the three evaluation periods (p>0.05). The silorane-based and the methacrylate-based nanoparticle resins presented similar tissue response to that of the empty tube (control group) after subcutaneous implantation in isogenic mice.
Resumo:
The main objective of this work was to compare two methods to estimate the deposition of pesticide applied by aerial spraying. Hundred and fifty pieces of water sensitive paper were distributed over an area of 50 m length by 75 m width for sampling droplets sprayed by an aircraft calibrated to apply a spray volume of 32 L/ha. The samples were analysed by visual microscopic method using NG 2 Porton graticule and by an image analyser computer program. The results reached by visual microscopic method were the following: volume median diameter, 398±62 mum; number median diameter, 159±22 mum; droplet density, 22.5±7.0 droplets/cm² and estimated deposited volume, 22.2±9.4 L/ha. The respective ones reached with the computer program were: 402±58 mum, 161±32 mum, 21.9±7.5 droplets/cm² and 21.9±9.2 L/ha. Graphs of the spatial distribution of droplet density and deposited spray volume on the area were produced by the computer program.
Resumo:
This paper presents a method to reconstruct 3D surfaces of silicon wafers from 2D images of printed circuits taken with a scanning electron microscope. Our reconstruction method combines the physical model of the optical acquisition system with prior knowledge about the shapes of the patterns in the circuit; the result is a shape-from-shading technique with a shape prior. The reconstruction of the surface is formulated as an optimization problem with an objective functional that combines a data-fidelity term on the microscopic image with two prior terms on the surface. The data term models the acquisition system through the irradiance equation characteristic of the microscope; the first prior is a smoothness penalty on the reconstructed surface, and the second prior constrains the shape of the surface to agree with the expected shape of the pattern in the circuit. In order to account for the variability of the manufacturing process, this second prior includes a deformation field that allows a nonlinear elastic deformation between the expected pattern and the reconstructed surface. As a result, the minimization problem has two unknowns, and the reconstruction method provides two outputs: 1) a reconstructed surface and 2) a deformation field. The reconstructed surface is derived from the shading observed in the image and the prior knowledge about the pattern in the circuit, while the deformation field produces a mapping between the expected shape and the reconstructed surface that provides a measure of deviation between the circuit design models and the real manufacturing process.
Resumo:
Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.
Resumo:
Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.
Resumo:
Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .
Resumo:
Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).
Resumo:
Arterial Spin Labeling (ASL) is a method to measure perfusion using magnetically labeled blood water as an endogenous tracer. Being fully non-invasive, this technique is attractive for longitudinal studies of cerebral blood flow in healthy and diseased individuals, or as a surrogate marker of metabolism. So far, ASL has been restricted mostly to specialist centers due to a generally low SNR of the method and potential issues with user-dependent analysis needed to obtain quantitative measurement of cerebral blood flow (CBF). Here, we evaluated a particular implementation of ASL (called Quantitative STAR labeling of Arterial Regions or QUASAR), a method providing user independent quantification of CBF in a large test-retest study across sites from around the world, dubbed "The QUASAR reproducibility study". Altogether, 28 sites located in Asia, Europe and North America participated and a total of 284 healthy volunteers were scanned. Minimal operator dependence was assured by using an automatic planning tool and its accuracy and potential usefulness in multi-center trials was evaluated as well. Accurate repositioning between sessions was achieved with the automatic planning tool showing mean displacements of 1.87+/-0.95 mm and rotations of 1.56+/-0.66 degrees . Mean gray matter CBF was 47.4+/-7.5 [ml/100 g/min] with a between-subject standard variation SD(b)=5.5 [ml/100 g/min] and a within-subject standard deviation SD(w)=4.7 [ml/100 g/min]. The corresponding repeatability was 13.0 [ml/100 g/min] and was found to be within the range of previous studies.
Resumo:
Due to the low workability of slipform concrete mixtures, the science of rheology is not strictly applicable for such concrete. However, the concept of rheological behavior may still be considered useful. A novel workability test method (Vibrating Kelly Ball or VKelly test) that would quantitatively assess the responsiveness of a dry concrete mixture to vibration, as is desired of a mixture suitable for slipform paving, was developed and evaluated. The objectives of this test method are for it to be cost-effective, portable, and repeatable while reporting the suitability of a mixture for use in slipform paving. The work to evaluate and refine the test was conducted in three phases: 1. Assess whether the VKelly test can signal variations in laboratory mixtures with a range of materials and proportions 2. Run the VKelly test in the field at a number of construction sites 3. Validate the VKelly test results using the Box Test developed at Oklahoma State University for slipform paving concrete The data collected to date indicate that the VKelly test appears to be suitable for assessing a mixture’s response to vibration (workability) with a low multiple operator variability. A unique parameter, VKelly Index, is introduced and defined that seems to indicate that a mixture is suitable for slipform paving when it falls in the range of 0.8 to 1.2 in./√s.