Flp recombinase promotes site-specific DNA recombination in embryonic stem cells and transgenic mice.

Site-specific recombinases are being developed as tools for "in vivo" genetic engineering because they can catalyze precise excisions, integrations, inversions, or translocations of DNA between their distinct recognition target sites. Here it is demonstrated that Flp recombinase can effectively mediate site-specific excisional recombination in mouse embryonic stem cells, in differentiating embryonal carcinoma cells, and in transgenic mice. Broad Flp expression is compatible with normal development, suggesting that Flp can be used to catalyze recombination in most cell types. These properties indicate that Flp can be exploited to make prescribed alterations in the mouse genome.

4-Oxoretinol, a new natural ligand and transactivator of the retinoic acid receptors.

All-trans-retinoic acid (at-RA) induces cell differentiation in a wide variety of cell types, including F9 embryonic teratocarcinoma cells, and can influence axial pattern formation during embryonic development. We now identify a novel retinoid synthetic pathway in differentiating F9 cells that results in the intracellular production of 4-oxoretinol (4-oxo-ROL) from retinol (vitamin A). Approximately 10-15% of the total retinol in the culture is metabolized to 4-hydroxyretinol and 4-oxo-ROL by the at-RA-treated, differentiating F9 cells over an 18-hr period, but no detectable metabolism of all-trans-retinol to at-RA or 9-cis-retinoic acid is observed in these cells. Remarkably, we show that 4-oxo-ROL can bind and activate transcription of the retinoic acid receptors whereas all-trans-retinol shows neither activity. Low doses of 4-oxo-ROL (e.g., 10(-9) or 10(-10 M) can activate the retinoic acid receptors even though, unlike at-RA, 4-oxo-ROL does not contain an acid moiety at the carbon 15 position. 4-oxo-ROL does not bind or transcriptionally activate the retinoid X receptors. Treatment of F9 cells with 4-oxo-ROL induces differentiation without conversion to the acid and 4-oxo-ROL is active in causing axial truncation when administered to Xenopus embryos at the blastula stage. Thus, 4-oxo-ROL is a natural, biologically active retinoid that is present in differentiated F9 cells. Our data suggest that 4-oxo-ROL may be a novel signaling molecule and regulator of cell differentiation.

BCL2 regulates neural differentiation.

A main function attributed to the BCL2 protein is its ability to confer resistance against apoptosis. In addition to the constitutively high expression of BCL2, caused by gene rearrangement in follicular lymphomas, elevated expression of the BCL2 gene has been found in differentiating hematopoietic, neural, and epithelial tissues. To address the question of whether the expression of BCL2 is a cause or consequence of cell differentiation, we used a human neural-crest-derived tumor cell line, Paju, that undergoes spontaneous neural differentiation in vitro. The Paju cell line displays moderate expression of BCL2, the level of which increases in parallel with further neural differentiation induced by treatment with phorbol 12-myristate 13-acetate. Transfection of normal human BCL2 cDNA in sense and antisense orientations had a dramatic impact on the differentiation of the Paju cells. Overexpression of BCL2 cDNA induced extensive neurite outgrowth, even in low serum concentrations, together with an increased expression of neuron-specific enolase. Paju cells expressing the anti-sense BCL2 cDNA construct, which reduced the endogenous levels of BCL2, did not undergo spontaneous neural differentiation. These cells acquired an epithelioid morphology and up-regulated the intermediate filament protein nestin, typically present in primitive neuroectodermal cells. The manipulated levels of BCL2 did not have appreciable impact on cell survival in normal culture. Our findings demonstrate that the BCL2 gene product participates in the regulation of neural differentiation.

The genetic link between the Chinese bamboo partridge (Bambusicola thoracica) and the chicken and junglefowls of the genus Gallus.

Further comparison of mitochondrial control-region DNA base sequences of 16 avian species belonging to the subfamily Phasianinae revealed the following: (i) Generalized perdicine birds (quails and partridges) are of ancient lineages. Even the closest pair, the common quail (Coturnix coturnix japonica) and the Chinese bamboo partridge (Bambusicola thoracica), maintained only 85.71% identity. (ii) The 12 species of phasianine birds previously and presently studied belonged to three distinct branches. The first branch was made exclusively of members of the genus Gallus, while the second branch was made of pheasants of the genera Phasianus, Chrysolophus, and Syrmaticus. Gallopheasants of the genus Lophura were distant cousins to these pheasants. The great argus (Argusianus argus) and peafowls of the genus Pavo constituted the third branch. The position of peacock-pheasants of the genus Polyplectron in the third branch was similar to that of the genus Lophura in the second branch. Members of the fourth phasianine branch, such as tragopans and monals, were not included in the present study. (iii) The one perdicine species, Bambusicola thoracica, was more closely related to phasianine genera Gallus and Pavo than to members of other perdicine genera. The above might indicate that Bambusicola belong to one-stem perdicine lineage that later splits into two sublineages that yielded phasianine birds, one evolving to Gallus, and the other differentiating toward Pavo and its allies.

Rapamycin inhibits clonal expansion and adipogenic differentiation of 3T3-L1 cells.

Differentiating 3T3-L1 cells express an immunophilin early during the adipocyte conversion program as described in this issue [Yeh, W.-C., Li, T.-K., Bierer, B. E. & McKnight, S. L. (1995) Proc. Natl. Acad. Sci. USA 92, 11081-11085]. The temporal expression profile of this protein, designated FK506-binding protein (FKBP) 51, is concordant with the clonal-expansion period undertaken by 3T3-L1 cells after exposure to adipogenic hormones. Having observed FKBP51 synthesis early during adipogenesis, we tested the effects of three immunosuppressive drugs--cyclosporin A, FK506, and rapamycin--on the terminal-differentiation process. Adipocyte conversion was not affected by either cyclosporin A or FK506 and yet was significantly reduced by rapamycin at drug concentrations as low as 10 nM. Clonal expansion was impeded in drug-treated cultures, as was the accumulation of cytoplasmic lipid droplets normally seen late during differentiation. Rapamycin treatment likewise inhibited the expression of CCAAT/enhancer binding protein alpha, a transcription factor required for 3T3-L1 cell differentiation. All three of these effects were reversed by high FK506 concentrations, indicating that the operative inhibitory event was mediated by an immunophilin-rapamycin complex.

Development of a safe live Leishmania vaccine line by gene replacement.

Vaccination with live Leishmania major has been shown to yield effective immunization in humans; however, this has been discontinued because of problems associated with virulence of the available vaccine lines. To circumvent this, we tested the ability of a dhfr-ts- null mutant of L. major, obtained by gene targeting, to infect and then to vaccinate mice against challenge with virulent L. major. Survival and replication of dhfr-ts- in macrophages in vitro were dependent upon thymidine, with parasites differentiating into amastigotes prior to destruction. dhfr-ts- parasites persisted in BALB/c mice for up to 2 months, declining with a half-life of 2-3 days. Nonetheless, dhfr-ts- was incapable of causing disease in both susceptible and immunodeficient (nu/nu) BALB/c mice. Animal infectivity could be partially restored by thymidine supplementation. When inoculated by the i.v., s.c., or i.m. routes into mice, dhfr-ts- could elicit substantial resistance to a subsequent challenge with virulent L. major. Thus, Leishmania bearing auxotrophic gene knockouts can be safe and induce protective immunity. Potentially, dhfr-ts- could be used as a platform for delivery of immunogens relevant to other diseases.

Normal development and function of natural killer cells in CD3 epsilon delta 5/delta 5 mutant mice.

The CD3 epsilon polypeptide contributes to the cell surface display as well as to the signal transduction properties of the T-cell antigen receptor complex. Intriguingly, the distribution of CD3 epsilon is not restricted to T cells, since activated mouse, human, and avian natural killer (NK) cells do express intracytoplasmic CD3 epsilon polypeptides. CD3 epsilon is also present in the cytoplasm of fetal thymic T/NK bipotential progenitor cells, suggesting that it constitutes a component of the NK differentiation program. We report here that the genetic disruption of CD3 epsilon exon 5 alters neither NK cell development nor in vitro and in vivo NK functions, although it profoundly blocked T-cell development. These results support the notion that CD3 epsilon is dispensable for mouse NK cell ontogeny and function and further suggest that the common NK/T-cell progenitor cell utilizes CD3 epsilon as a mandatory component only when differentiating toward the T-cell lineage.

Mice develop normally without the H1(0) linker histone.

H1 histones bind to the linker DNA between nucleosome core particles and facilitate the folding of chromatin into a 30-nm fiber. Mice contain at least seven nonallelic subtypes of H1, including the somatic variants H1a through H1e, the testis-specific variant H1t, and the replacement linker histone H1(0). H1(0) accumulates in terminally differentiating cells from many lineages, at about the time when the cells cease dividing. To investigate the role of H1(0) in development, we have disrupted the single-copy H1(0) gene by homologous recombination in mouse embryonic stem cells. Mice homozygous for the mutation and completely lacking H1(0) mRNA and protein grew and reproduced normally and exhibited no anatomic or histologic abnormalities. Examination of tissues in which H1(0) is normally present at high levels also failed to reveal any abnormality in cell division patterns. Chromatin from H1(0)-deficient animals showed no significant change in the relative proportions of the other H1 subtypes or in the stoichiometry between linker histones and nucleosomes, suggesting that the other H1 histones can compensate for the deficiency in H1(0) by occupying sites that normally contain H1(0). Our results indicate that despite the unique properties and expression pattern of H1(0), its function is dispensable for normal mouse development.

An apoptotic defect in lens differentiation caused by human p53 is rescued by a mutant allele.

If deprived of wild-type p53 function, the body loses a guardian that protects against cancer. Restoration of p53 function has, therefore, been proposed as a means of counteracting oncogenesis. This concept of therapy requires prior knowledge with regard to proper balance of p53 function in a given target tissue. We have addressed this problem by targeting expression of the wild-type human p53 gene to the lens, a tissue entirely composed of epithelial cells that differentiate into elongated fiber cells. Transgenic mice expressing wild-type human p53 develop microphthalmia as a result of a defect in fiber formation that sets in shortly after birth. We see apoptotic cells that fail to undergo proper differentiation. In an effort to directly link the observed lens phenotype to the activity of the wild-type human p53 transgene, we also generated mice expressing a mutant human p53 allele that lacks wild-type function. A normal lens phenotype is restored in double transgenic animals that carry both wild-type and mutant human p53 alleles. Our study highlights the difficulties that can arise if p53 levels are improperly balanced in a differentiating tissue.

Insulin-like growth factor I receptors of fetal brain are enriched in nerve growth cones and contain a beta-subunit variant.

Nerve growth cones isolated from fetal rat brain are highly enriched in a 97-kDa glycoprotein, termed beta gc, that comigrates with the beta subunit of the IGF-I receptor upon two-dimensional PAGE and is disulfide-linked to this receptor's alpha subunit. Antibodies prepared to a conserved domain shared by the insulin and IGF-I receptor beta subunits (AbP2) or to beta gc were used to study receptor distribution further. Subcellular fractionation of the fetal brain segregated most AbP2 immunoreactivity away from growth cones, whereas most beta gc immunoreactivity copurified with growth cones. Experiments involving ligand-activated receptor autophosphorylation confirmed the concentration of IGF-I but not of insulin receptors in growth cone fractions. These results indicate the enrichment of IGF-I receptors in (presumably axonal) growth cones of the differentiating neuron. Furthermore, the segregation of beta gc from AbP2 immunoreactivity suggests that such neurons express an immunochemically distinct variant of the IGF-I receptor beta subunit at the growth cone.

Phosphorylation of ubiquitin-activating enzyme in cultured cells.

Ubiquitin-activating enzyme, E1, is the first enzyme in the pathway leading to formation of ubiquitin-protein conjugates. E1 exists as two isoforms in human cells which are separable by electrophoresis. These isoforms migrate with apparent molecular sizes of 110 kDa and 117 kDa in SDS/polyacrylamide gels. Immunoprecipitation of E1 from lysates of HeLa cells metabolically labeled with [32P]phosphate indicated the presence of a phosphorylated form of E1 which migrates at 117 kDa. Phospho amino acid analysis identified serine as the phosphorylated residue in E1. Phosphorylated E1 was also detected in normal and transformed cells from another human cell line. Phosphatase-catalyzed dephosphorylation of E1 in vitro did not eliminate the 117-kDa E1 isoform detected by Coomassie staining after SDS/polyacrylamide gel electrophoresis, thereby demonstrating that phosphorylation is not the sole structural feature differentiating the isoforms of E1. These observations suggest new hypotheses concerning mechanisms of metabolic regulation of the ubiquitin conjugation pathway.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Electrical investigation of p-type 4H-SiC heavily doped by ion implantation

In the last decades, an increasing interest in the research field of wide bandgap semiconductors was observed, mostly due to the progressive approaching of silicon-based devices to their theoretical limits. 4H-SiC is an example among these, and is a mature compound for applications. The main advantages offered 4H-SiC in comparison with silicon are an higher breakdown field, an higher thermal conductivity, a higher operating temperature, very high hardness and melting point, biocompatibility, but also low switching losses in high frequencies applications and lower on-resistances in unipolar devices. Then, 4H-SiC power devices offer great performance improvement; moreover, they can work in hostile environments where silicon power devices cannot function. Ion implantation technology is a key process in the fabrication of almost all kinds of SiC devices, owing to the advantage of a spatially selective doping. This work is dedicated to the electrical investigation of several differently-processed 4H-SiC ion- implanted samples, mainly through Hall effect and space charge spectroscopy experiments. It was also developed the automatic control (Labview) of several experiments. In the work, the effectiveness of high temperature post-implant thermal treatments (up to 2000°C) were studied and compared considering: (i) different methods, (ii) different temperatures and (iii) different duration of the annealing process. Preliminary p + /n and Schottky junctions were also investigated as simple test devices. 1) Heavy doping by ion implantation of single off-axis 4H-SiC layers The electrical investigation is one of the most important characterization of ion-implanted samples, which must be submitted to mandatory post-implant thermal treatment in order to both (i) recover the lattice after ion bombardment, and (ii) address the implanted impurities into lattice sites so that they can effectively act as dopants. Electrical investigation can give fundamental information on the efficiency of the electrical impurity activation. To understand the results of the research it should be noted that: (a) To realize good ohmic contacts it is necessary to obtain spatially defined highly doped regions, which must have conductivity as low as possible. (b) It has been shown that the electrical activation efficiency and the electrical conductivity increase with the annealing temperature increasing. (c) To maximize the layer conductivity, temperatures around 1700°C are generally used and implantation density high till to 10 21 cm -3 . In this work, an original approach, different from (c), is explored by the using very high annealing temperature, around 2000°C, on samples of Al + -implant concentration of the order of 10 20 cm -3 . Several Al + -implanted 4H-SiC samples, resulting of p-type conductivity, were investigated, with a nominal density varying in the range of about 1-5∙10 20 cm -3 and subjected to two different high temperature thermal treatments. One annealing method uses a radiofrequency heated furnace till to 1950°C (Conventional Annealing, CA), the other exploits a microwave field, providing a fast heating rate up to 2000°C (Micro-Wave Annealing, MWA). In this contest, mainly ion implanted p-type samples were investigated, both off-axis and on-axis <0001> semi-insulating 4H-SiC. Concerning p-type off-axis samples, a high electrical activation of implanted Al (50-70%) and a compensation ratio below 10% were estimated. In the work, the main sample processing parameters have been varied, as the implant temperature, CA annealing duration, and heating/cooling rates, and the best values assessed. MWA method leads to higher hole density and lower mobility than CA in equivalent ion implanted layers, resulting in lower resistivity, probably related to the 50°C higher annealing temperature. An optimal duration of the CA treatment was estimated in about 12-13 minutes. A RT resistivity on the lowest reported in literature for this kind of samples, has been obtained. 2) Low resistivity data: variable range hopping Notwithstanding the heavy p-type doping levels, the carrier density remained less than the critical one required for a semiconductor to metal transition. However, the high carrier densities obtained was enough to trigger a low temperature impurity band (IB) conduction. In the heaviest doped samples, such a conduction mechanism persists till to RT, without significantly prejudice the mobility values. This feature can have an interesting technological fall, because it guarantee a nearly temperature- independent carrier density, it being not affected by freeze-out effects. The usual transport mechanism occurring in the IB conduction is the nearest neighbor hopping: such a regime is effectively consistent with the resistivity temperature behavior of the lowest doped samples. In the heavier doped samples, however, a trend of the resistivity data compatible with a variable range hopping (VRH) conduction has been pointed out, here highlighted for the first time in p-type 4H-SiC. Even more: in the heaviest doped samples, and in particular, in those annealed by MWA, the temperature dependence of the resistivity data is consistent with a reduced dimensionality (2D) of the VRH conduction. In these samples, TEM investigation pointed out faulted dislocation loops in the basal plane, whose average spacing along the c-axis is comparable with the optimal length of the hops in the VRH transport. This result suggested the assignment of such a peculiar behavior to a kind of spatial confinement into a plane of the carrier hops. 3) Test device the p + -n junction In the last part of the work, the electrical properties of 4H-SiC diodes were also studied. In this case, a heavy Al + ion implantation was realized on n-type epilayers, according to the technological process applied for final devices. Good rectification properties was shown from these preliminary devices in their current-voltage characteristics. Admittance spectroscopy and deep level transient spectroscopy measurements showed the presence of electrically active defects other than the dopants ones, induced in the active region of the diodes by ion implantation. A critical comparison with the literature of these defects was performed. Preliminary to such an investigation, it was assessed the experimental set up for the admittance spectroscopy and current-voltage investigation and the automatic control of these measurements.

Family firms and the great crisis: evidence from the italian case

Few studies have analyzed how family firms have acted during the global great crisis in comparison to their nonfamily counterparts. This paper tries to fill this gap on the basis of the Italian experience using a sample of almost 4,500 for 2007 and 2010. We study whether family control affects labour productivity, labour costs and competitiveness and if the adoption of performance related pay (PRP) reveals an efficacious strategy to mitigate the effects of the crisis and reduce the gap in competitiveness with respect to nonfamily firms. We use quantile regression techniques to test the heterogeneous role of PRP and pay attention for its possible endogeneity. We have observed that after the outburst of the crisis, the distance in terms of competitiveness of family firms with respect to their nonfamily counterparts has been amplified. We also find that family firms may take advantage from the adoption of incentive schemes, such as PRP, to encourage commitment and motivation from their employees more than nonfamily firms. The positive role of PRP on labour productivity, coupled with a moderate influence of these schemes on wage premiums, enable them to regain competitiveness also under hostile pressures, as those featuring the strong global crisis.

A construção da parentalidade na interação com filhos com Síndrome de Down

No Brasil nasce uma criança com Síndrome de Down (SD) a cada 600 nascimentos, o que representa aproximadamente 8.000 bebês com SD por ano. As peculiaridades no desenvolvimento dessas crianças exigem que os pais desenvolvam habilidades especiais para contemplarem cada necessidade diferenciada da criança que poderia passar despercebida ou facilmente captada nas crianças sem nenhum tipo de Síndrome. A interação com os pais, agentes primordiais nesse processo, é essencial, inclusive, para minimizar os efeitos da Síndrome; porém pouco se tem estudado sobre a vivência dos cuidadores no encontro com a criança. Nesse contexto, objetivou-se compreender como se deu a construção do \"ser pai/mãe\" de uma criança com Síndrome de Down, desde o diagnóstico da Síndrome de Down até o momento da entrevista. Para tanto se utilizou o método clínico-qualitativo, através do estudo de caso coletivo. Como referencial teórico para análise a psicanálise winnicottiana. Realizou-se entrevistas semiabertas, individuais, face a face, com 5 casais de pais de crianças com Síndrome de Down, com idade de 7 a 10 anos. As entrevistas foram audiogravadas e transcritas na íntegra. Os resultados foram apresentados através de quatro categorias, a saber: \"Amor a segunda vista\" aborda o processo interativo inicial, os pais relatam o choque ao receber a notícia da Síndrome e os desafios na readaptação dos sonhos e expectativas. \"O ambiente lugar e não lugar\" descreve como os pais perceberam os diversos ambientes, alguns hostis que não contribuíram para que os mesmos pudessem ser acolhidos e potencializados na tarefa de cuidar desse filho, ressaltando que a ausência de suporte acarreta em sobrecarga na percepção dos pais; Por outro lado, consideram que o maior suporte que tiveram foi do parceiro, o que auxiliou na aceitação da notícia e em encontrar possibilidades de cuidado. \"Encontro Suficientemente Bom\" coloca em relevo a descrição dos participantes de que há maneiras diferentes de ajustar o cuidado na interação com seus filhos que perpassaram tanto por incômodos, quanto pela possibilidade do gesto criativo que se apresenta em atividades triviais e importantes do desenvolvimento. \"Trans-formações\" destaca às mudanças que os pais vivenciam ao poder se aproximar do filho \"real\", assumindo novos papéis, transformando-se através da abertura ao novo do outro e de si mesmos. A partir desse estudo pôde-se compreender que a relação vai se constituindo e se regulando reciprocamente, os cuidados precisam ser ajustados à demanda e possibilidade do outro. Compreendeu-se, ainda, que criatividade é a característica que permite que os pais sejam espontâneoss e recontruam significados e modos de interagir pessoais com seus filhos. Os pais entrevistados indicam que quanto mais lento e exigente o cuidado com seus filhos com Síndrome de Down, mais possibilidades de encontros surgem, e quando esses podem ser suficientemente bons, são \"trans-formadores\" para ambos: pais e filho. Ampliou-se a compreensão quanto a necessidade de acolhimento às angústias vividas, e suporte para o processo da construção da parentalidade.