Produção de metano em caprinos sob pastejo

Pós-graduação em Zootecnia - FCAV

Comparação ente dois métodos de inseminação artificial utilizando sêmem congelado em gatos domésticos(Felis catus)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação do efeito da umidade relativa do ar no coeficiente de performance de um sistema de ar condicionado

Os fatores que influenciam no consumo de energia de um sistema de ar condicionado de pequeno porte, que merecem destaque são a eficiência do compressor através do modelo empregado, a forma que a vazão do refrigerante é condicionada, o modelo do ventilador empregado, o rendimento do evaporador, o condensador e as condições climáticas. Dentro da questão climática, uma questão bastante interessante é que a umidade relativa do ar, quando se trata do efeito que ela causa, principalmente no rendimento do condensador a ar, em geral não é considerada nos projetos. Este trabalho tem como objetivo avaliar a influência da umidade relativa do ar no coeficiente de performance do sistema (COP), procurando quantificar sua influência nas respectivas faixas em que elas acontecem. Nos resultados encontrados foi possível identificar que existe uma influência bastante significativa, principalmente quando comparam-se condições de alta umidade com de baixa umidade destacando que somente a partir da 65% de umidade relativa é que encontra-se alterações significativas no COP do sistema

Estudo das catelicidinas no plasma seminal de garanhões e das interleucinas na resposta inflamatória pós-iseminação artificial em éguas

Pós-graduação em Medicina Veterinária - FMVZ

Criopreservação e fertilidade de espermatozoides do ejaculado e recuperados da cauda do epidídimo de garanhões subférteis

Pós-graduação em Medicina Veterinária - FMVZ

Efeitos da sexagem por citometria de fluxo sobre a composição protéica da membrana de espermatozóides bovinos

Pós-graduação em Medicina Veterinária - FMVZ

Indução a espermiação do mandi-pintado, Pimelodus britskii no período reprodutivo (Teleostei: Pimelodidae)

Pós-graduação em Aquicultura - FCAV

Parâmetros seminais, ultraestruturais, criopreservação e androgênese de espécies do gênero Brycon ameaçadas de extinção

Pós-graduação em Aquicultura - FCAV

Dispositivo para controle da contaminação microbiana dos fluidos de corte com utilização de baixa temperatura

A presente patente diz respeito a um dispositivo de refrigeração de fluidos de corte interligado em máquinas de usinagem, retificadoras e/ou de corte, visando reduzir a contaminação microbiana dos fluidos de corte, oferecendo, paralelamente, maior poder de refrigeração sobre a peça e a ferramenta de corte, composto por caixa de resfriamento (2) com serpentina em banho de gelo ou um refrigerador de líquidos (2A), depósito do fluido (3), sendo que a caixa de resfriamento e o depósito de fluido são revestidos com material isolante térmico (4) e devidamente interligados por tubos (5).

Sistema compacto de cogeração com motor de combustão interna

Sistema compacto de cogeração com motor de combustão interna compreendendo a interligação mecânica de um motor de combustão interna (M), operando com gasolina e ou gás, com um gerador de eletricidade (G), e um trocador de calor água/água (TC1), onde a troca de calor ocorre entre a água proveniente do conjunto de refrigeração do motor (M) e a água a ser aquecida proveniente da rede de abastecimento...

Padronização do Elisa indireto e Western Blot para diagnóstico da artrite-encefalite caprina

Caprine arthritis-encephalitis (CAE) is routinely diagnosed with the Agarose Gel Immunodiffusion (AGID) technique, which is considered to have low sensitivity. The objective of this study was to standardize testing i-Elisa and Western Blot for early detection of antibodies against CAEV in goats and compare the results obtained in these tests with proof of AGID. For standardization of i-Elisa and WB, different concentrations and dilutions of antigen, sera and conjugate were used. In the i-Elisa, rigid microplate with 96 wells was adopted, and the combination that showed the best result was a concentration of 0.5µg/ well of antigen and dilutions of the serum of 1:100 and conjugate of 1:1500. In the WB nitrocellulose membranes were used, and the dilutions of the serum were defined at 1:50 and conjugate at 1:15000. To evaluate the performance of the techniques, 222 goat serum samples were tested and the data were compared with the AGID. The sensitivity and specificity of Elisa-i/IDGA, WB/AGID and WB/Elisa-i were 70% and 91%, 100% and 72.6%, 84.6% and 76.5%, concomitantly. The Kappa index of these tests was 0.35, 0.2 and 0.36, respectively. The i-Elisa and WB techniques were more sensitive than the AGID and can be used as tools for early diagnosis of CAE.

The seasonal and ovarian status effects on in vitro production of domestic cat embryos between Equator and Tropic of Capricorn

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Reproductive efficiency of adult and prepubertal goats subjected to repeated follicular aspiration

The objective of this study was to assess the reproductive response of adult and prepubertal goats subjected to repeated laparoscopic ovum pick-up (LOPU). The study animals were divided into two groups, specifically, adult nanny goats (GA, n=10) and prepubertal nanny goats (GP, n=10), which were subjected to estrous synchronization and ovarian stimulation for LOPU. Both groups underwent six LOPU procedures at seven-day intervals and were subsequently subjected to controlled mating and pregnancy diagnosis to evaluate their future fertility. The study showed a reduction in the number of follicles visualized and in the amount and quality of the oocytes that were recovered and exposed to in vitro maturation. As indicated by the fertility test, however, no complications were found during the laparoscopic procedures that would impair the reproductive future of the animals. Therefore, a viable number of oocytes were obtained even with the decreased reproductive efficiency, proving that repeated LOPUs do not interfere with the reproductive of adult and prepubertal nanny goats. These results indicate a positive aspect of this procedure, allowing for increasing reproductive performance of this kind, when used for the production in vitro.

Aspectos reprodutivos, morfologia dos gametas e desenvolvimento embrionário de Astyanax altiparanae Garutti & Britski (Teleostei, Characidae)

Pós-graduação em Aquicultura - FCAV