980 resultados para Grünwald-Letnikov derivative


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The key intermediate 1,2:5,6-di-O-isopropylidene-3-deoxy-3 beta-allyl-alpha-D-glucofuranose (8) could be conveniently prepared through radical induced allyl substitution at C-3 of appropriate 1,2:5,6-di-O-isopropylidene-alpha-D-glucofuranose derivatives (7a,b) and used to synthesize enantiomeric bishydroxymethyl aminocyclopentanols 13 and 19 by the application of a 1,3-dipolar nitrone cycloaddition reaction involving the C-5 or C-1 aldehyde functionality. The products were subsequently transformed into carbanucleoside enantiomers 15 and 21. The diastercomeric isoxazolidinocyclopentane derivative 20 was similarly converted to carbanucleoside 22. (c) 2006 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A chemically coated piezoelectric sensor has been developed for the determination of PAHs in the liquid phase. An organic monolayer attached to the surface of a gold electrode of a quartz crystal microbalance (QCM) via a covalent thiol-gold link complete with an ionically bound recognition element has been produced. This study has employed the PAH derivative 9-anthracene carboxylic acid which, once bound to the alkane thiol, functions as the recognition element. Binding of anthracene via pi-pi interaction has been observed as a frequency shift in the QCM with a detectability of the target analyte of 2 ppb and a response range of 0-50 ppb. The relative response of the sensor altered for different PAHs despite pi-pi interaction being the sole communication between recognition element and analyte. It is envisaged that such a sensor could be employed in the identification of key marker compounds and, as such, give an indication of total PAH flux in the environment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In contrast to the corresponding hydroxyiodination reactions, the reaction of acetoxycyclohex-2-ene 1 with N-PSP in the presence of water shows little regiocontrol, but is highly diastereoselective. However, the same reaction of the (R)-phenylglycinate derivative of (+/-)-cyclohexen-3-ol is highly diastereoselective, and regioselective. A hydrogen-bonding interaction is proposed to rationalize these differing selectivities. (c) 2007 Published by Elsevier Ltd.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The role of metal ions in determining the solution conformation of the Holliday junction is well established, but to date the picture of metal ion binding from structural studies of the four-way DNA junction is very incomplete. Here we present two refined structures of the Holliday junction formed by the sequence d(TCGGTACCGA) in the presence of Na+ and Ca2+, and separately with Sr2+ to resolutions of 1.85 Angstrom and 1.65 Angstrom, respectively. This sequence includes the ACC core found to promote spontaneous junction formation, but its structure has not previously been reported. Almost complete hydration spheres can be defined for each metal cation. The Na+ sites, the most convincing observation of such sites in junctions to date, are one on either face of the junction crossover region, and stabilise the ordered hydration inside the junction arms. The four Ca2+ sites in the same structure are at the CG/CG steps in the minor groove. The Sr2+ ions occupy the TC/AG, GG/CC, and TA/TA sites in the minor groove, giving ten positions forming two spines of ions, spiralling through the minor grooves within each arm of the stacked-X structure. The two structures were solved in the two different C2 lattices previously observed, with the Sr2+ derivative crystallising in the more highly symmetrical form with two-fold symmetry at its centre. Both structures show an opening of the minor groove face of the junction of 8.4degrees in the Ca2+ and Na+ containing structure, and 13.4degrees in the Sr2+ containing structure. The crossover angles at the junction are 39.3degrees and 43.3degrees, respectively. In addition to this, a relative shift in the base pair stack alignment of the arms of 2.3 Angstrom is observed for the Sr2+ containing structure only. Overall these results provide an insight into the so-far elusive stabilising ion structure for the DNA Holliday junction. (C) 2003 Elsevier Science Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Two new silver-antimony sulfides, [C2H9N2][Ag2SbS3] (1) and [C2H9N2](2)[Ag5Sb3S8] (2), have been prepared solvothermally in the presence of ethylenediamine and characterized by single-crystal X-ray diffraction, thermogravimetry, and elemental analysis. Compound 1 crystallizes in the space group Pn (a = 6.1781(1) Angstrom, b =11.9491(3) Angstrom, c = 6.9239(2) Angstrom, =111.164(1)degrees) and 2 in the space group Pm (a = 6.2215(2) Angstrom, b = 15.7707(7) Angstrom, c = 11.6478(5) Angstrom, beta = 92.645(2)degrees). The structure of 1 consists of chains of fused five-membered Ag2SbS2 rings linked to form layers, between which the template molecules reside. Compound 2 contains honeycomb-like sheets of fused silver-antimony-sulfide six-membered rings linked to form double layers. The idealized structure can be considered to be an ordered defect derivative of that of lithium bismuthide, Li3Bi, and represents a new solid-state structure type.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Studies have suggested that diets rich in polyphenols Such as flavonoids may lead to a reduced risk of gastrointestinal cancers. We demonstrate the ability of monomeric and dimeric flavanols to scavenge reactive nitrogen species derived from nitrous acid. Both epicatechin and dimer B2 (epicatechin dimer) inhibited nitrous acid-induced formation of 3-nitrotyrosine and the formation of the carcinogenic N-nitrosamine, N-nitrosodimethylamine. The reaction of monomeric and dimeric epicatechin with nitrous acid led to the formation of mono- and di-nitroso flavanols, whereas the reaction with hesperetin resulted primarily in the formation of nitrated products. Although, epicatechin was transferred across the jejunum of the small intestine yielding metabolites, its nitroso form was not absorbed. Dimer B2 but not epicatechin monomer inhibited the proliferation of, and triggered apoptosis in, Caco-2 cells. The latter was accompanied by caspase-3 activation and reductions in Akt phosphorylation, suggesting activation of apoptosis via inhibition of prosurvival signaling. Furthermore, the dinitroso derivative of dimer B2, and to a lesser extent the dinitroso-epicatechin, also induced significant toxic effects in Caco-2 cells. The inhibitory effects on cellular proliferation were paralleled by early inhibition of ERK 1/2 phosphorylation and later reductions in cyclin D I levels, indicating modulation of cell cycle regulation in Caco-2 cells. These effects highlight multiple routes in which dietary derived flavanols may exert beneficial effects in the gastrointestinal tract. (c) 2005 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have conducted a detailed investigation into the absorption, metabolism and microflora-dependent transformation of hydroxytyrosol ( HT), tyrosol (TYR) and their conjugated forms, such as oleuropein (OL). Conjugated forms underwent rapid hydrolysis under gastric conditions, resulting in significant increases in the amount of free HT and TYR entering the small intestine. Both HT and TYR transferred across human Caco-2 cell monolayers and rat segments of jejunum and ileum and were subject to classic phase I/II biotransformation. The major metabolites identified were an O-methylated derivative of HT, glucuronides of HT and TYR and a novel glutathionylated conjugate of HT. In contrast, there was no absorption of OL in either model. However, OL was rapidly degraded by the colonic microflora resulting in the formation of HT. Our study provides additional information regarding the breakdown of complex olive oil polyphenols in the GI tract, in particular the stomach and the large intestine.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new homo-proline tetrazole derivative 7 has been prepared and shown to have improved properties for achieving asymmetric Michael addition of carbonyl compounds to nitro-olefins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Psoralens are well-known photosensitizers, and 8- methoxypsoralen and 4,5',8-trimethylpsoralen are widely used in photomedicine as "psoralens plus UVA therapy" (PUVA), in photopheresis, and in sterilization of blood preparations. In an attempt to improve the therapeutic efficiency of PUVA therapy and photopheresis, four poly(ethylene glycol) (PEG)-psoralen conjugates were synthesized to promote tumor targeting by the enhanced permeability and retention (EPR) effect. Peptide linkers were used to exploit specific enzymatic cleavage by lysosomal proteases. A new psoralen, 4-hydroxymethyl-4', 8-dimethylpsoralen (6), suitable for polymer conjugation was synthesized. The hydroxy group allowed exploring different strategies for PEG conjugation, and linkages with different stability such ester or urethanes were obtained. PEG (5 kDa) was covalently conjugated to the new psoralen derivative using four different linkages, namely, (i) direct ester bond (7), (ii) ester linkage with a peptide spacer (8), (iii) a carbamic linker (9), and (iv) a carbamic linker with a peptide spacer (12). The stability of these new conjugates was assessed at different pHs, in plasma and following incubation with cathepsin B. Conjugates 7 and 8 were rapidly hydrolyzed in plasma, while 9 was stable in buffer and in the presence of cathepsin B. As expected, only the conjugates containing the peptide linker released the drug in presence of cathepsin B. In vitro evaluation of the cytotoxic activity in the presence and absence of light was carried out in two cell lines (MCF-7 and A375 cells). Conjugates 7 and 8 displayed a similar activity to the free drug (probably due to the low stability of the ester linkage). Interestingly, the conjugates containing the carbamate linkage (9 and 12) were completely inactive in the dark (IC50 > 100 mu M in both cell lines). However, antiproliferative activity become apparent after UV irradiation. Conjugate 12 appears to be the most promising for future in vivo evaluation, since it was relatively stable in plasma, which should allow tumor targeting and drug release to occur by cathepsin B-mediated hydrolysis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper presents a novel intelligent multiple-controller framework incorporating a fuzzy-logic-based switching and tuning supervisor along with a generalised learning model (GLM) for an autonomous cruise control application. The proposed methodology combines the benefits of a conventional proportional-integral-derivative (PID) controller, and a PID structure-based (simultaneous) zero and pole placement controller. The switching decision between the two nonlinear fixed structure controllers is made on the basis of the required performance measure using a fuzzy-logic-based supervisor, operating at the highest level of the system. The supervisor is also employed to adaptively tune the parameters of the multiple controllers in order to achieve the desired closed-loop system performance. The intelligent multiple-controller framework is applied to the autonomous cruise control problem in order to maintain a desired vehicle speed by controlling the throttle plate angle in an electronic throttle control (ETC) system. Sample simulation results using a validated nonlinear vehicle model are used to demonstrate the effectiveness of the multiple-controller with respect to adaptively tracking the desired vehicle speed changes and achieving the desired speed of response, whilst penalising excessive control action. Crown Copyright (C) 2008 Published by Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fractionation of a MeOH/CH2Cl2 (1/1) extract of the aerial parts of Senecio erechtitoides led to the isolation of six compounds including the hitherto unknown N-phenethylamide derivative named N-(p-hydroxyphenethyl)pentacosanamide (1), and a kauranoid derivative named derivative named ent-7-oxo-16 alpha,17-dihydroxykauran-19-oic acid (2), as well as four known compounds, ent-Kaur-16-en-19-oic acid (3), ent-7 beta-hydroxykaur-16-en-19-oic acid (4), ent-7-oxokaur-16-en-19-oic acid (5), steppogenin 4′-O-beta-d-glucoside (6). Their structures and relative configurations were elucidated on the basis of spectroscopic methods, chemical reactions, and comparison with previously known analogs. All isolates were evaluated for their antimicrobial activity and only diterpenoids were found to possess a potent inhibitor effect against the range of microorganism.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

IR, UV-vis, and EPR spectroelectrochemistry at variable temperatures and in different solvents were applied to investigate in situ the formation of electroactive molecular chains with a nonbridged Os-Os backbone, in particular, the polymer [Os-0(bpy)(CO)(2)](n), (bpy = 2,2'-bipyridine), from a mononuclear Os(II) carbonyl precursor, [Os-II(bpy)(CO)(2)Cl-2]. The one-electron-reduced form, [Os-II(bpy(.-))(CO)(2)Cl-2](-), has been characterized spectroscopically at low temperatures. This radical anion is the key intermediate in the electrochemical propagation process responsible for the metal-metal bond formation. Unambiguous spectroscopic evidence has been gained also for the formation of [{Os-0(bpy(.-))(CO)(2)}(-)](n), the electron-rich electrocatalyst of CO2 reduction. The polymer species are fairly well soluble in butyronitrile, which is important for their potential utilization in nanoscience, for example, as conducting molecular wires. We have also shown that complete solubility is accomplished for the monocarbonyl-acetonitrile derivative of the polymer, [Os-0(bpy)(CO)(MeCN)(2)Cl](n).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Electrochemical and photochemical properties of the tetrahedral cluster [Ru3Ir(mu(3)-H)(CO)(13)] were studied in order to prove whether the previously established thermal conversion of this cluster into the hydrogenated derivative [Ru3Ir(mu-H)(3)(CO)(12)] also occurs by means of redox or photochemical activation. Two-electron reduction of [Ru3Ir(mu(3)-H)(CO)(13)] results in the loss of CO and concomitant formation of the dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-). The latter reduction product is stable in CH2Cl2 at low temperatures but becomes partly protonated above 283 K into the anion [Ru3Ir(mu-H)(2)(CO)(12)](-) by traces of water. The dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-) is also the product of the electrochemical reduction of [Ru3Ir(mu-H)(3)(CO)(12)] accompanied by the loss of H-2. Stepwise deprotonation of [Ru3Ir(mu-H)(3)(CO)(12)] with Et4NOH yields [Ru3Ir(mu-H)(2)(CO)(12)](-) and [Ru3Ir(mu(3)-H)(CO)(12)](2-). Reverse protonation of the anionic clusters can be achieved, e. g., with trifluoromethylsulfonic acid. Thus, the electrochemical conversion of [Ru3Ir(mu(3)-H)(CO)(13)] into [Ru3Ir(mu-H)(3)(CO)(12)] is feasible, demanding separate two-electron reduction and protonation steps. Irradiation into the visible absorption band of [Ru3Ir(mu3-H)(CO)(13)] in hexane does not induce any significant photochemical conversion. Irradiation of this cluster in the presence of CO with lambda(irr) > 340 nm, however, triggers its efficient photofragmentation into reactive unsaturated ruthenium and iridium carbonyl fragments. These fragments are either stabilised by dissolved CO or undergo reclusterification to give homonuclear clusters. Most importantly, in H-2-saturated hexane, [Ru3Ir(mu(3)-H)(CO)(13)] converts selectively into the [Ru3Ir(mu-H)(3)(CO)(12)] photoproduct. This conversion is particularly efficient at lambda(irr) > 340 nm.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Rifaximin, a rifamycin derivative, has been reported to induce clinical remission of active Crohn's disease (CD), a chronic inflammatory bowel disorder. In order to understand how rifaximin affects the colonic microbiota and its metabolism, an in vitro human colonic model system was used in this study. We investigated the impact of the administration of 1800 mg/day of rifaximin on the faecal microbiota of four patients affected by colonic active CD [Crohn's disease activity index (CDAI > 200)] using a continuous culture colonic model system. We studied the effect of rifaximin on the human gut microbiota using fluorescence in situ hybridization, quantitative PCR and PCR–denaturing gradient gel electrophoresis. Furthermore, we investigated the effect of the antibiotic on microbial metabolic profiles, using 1H-NMR and solid phase microextraction coupled with gas chromatography/mass spectrometry, and its potential genotoxicity and cytotoxicity, using Comet and growth curve assays. Rifaximin did not affect the overall composition of the gut microbiota, whereas it caused an increase in concentration of Bifidobacterium, Atopobium and Faecalibacterium prausnitzii. A shift in microbial metabolism was observed, as shown by increases in short-chain fatty acids, propanol, decanol, nonanone and aromatic organic compounds, and decreases in ethanol, methanol and glutamate. No genotoxicity or cytotoxicity was attributed to rifaximin, and conversely rifaximin was shown to have a chemopreventive role by protecting against hydrogen peroxide-induced DNA damage. We demonstrated that rifaximin, while not altering the overall structure of the human colonic microbiota, increased bifidobacteria and led to variation of metabolic profiles associated with potential beneficial effects on the host.