968 resultados para Cysteine-Rich Protein 61


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chang S, Gomes CM, Hypolite JA, Marx J, Alanzi J, Zderic SA, Malkowicz B, Wein AJ, Chacko S. Detrusor overactivity is associated with downregulation of large-conductance calcium-and voltage-activated potassium channel protein. Am J Physiol Renal Physiol 298: F1416-F1423, 2010. First published April 14, 2010; doi: 10.1152/ajprenal.00595.2009.-Large-conductance voltage-and calcium-activated potassium (BK) channels have been shown to play a role in detrusor overactivity (DO). The goal of this study was to determine whether bladder outlet obstructioninduced DO is associated with downregulation of BK channels and whether BK channels affect myosin light chain 20 (MLC(20)) phosphorylation in detrusor smooth muscle (DSM). Partial bladder outlet obstruction (PBOO) was surgically induced in male New Zealand White rabbits. The rabbit PBOO model shows decreased voided volumes and increased voiding frequency. DSM from PBOO rabbits also show enhanced spontaneous contractions compared with control. Both BK channel alpha- and beta-subunits were significantly decreased in DSM from PBOO rabbits. Immunostaining shows BK beta mainly expressed in DSM, and its expression is much less in PBOO DSM compared with control DSM. Furthermore, a translational study was performed to see whether the finding discovered in the animal model can be translated to human patients. The urodynamic study demonstrates several overactive DSM contractions during the urine-filling stage in benign prostatic hyperplasia (BPH) patients with DO, while DSM is very quiet in BPH patients without DO. DSM biopsies revealed significantly less BK channel expression at both mRNA and protein levels. The degree of downregulation of the BK beta-subunit was greater than that of the BK alpha-subunit, and the downregulation of BK was only associated with DO, not BPH. Finally, the small interference (si) RNA-mediated downregulation of the BK beta-subunit was employed to study the effect of BK depletion on MLC(20) phosphorylation. siRNA-mediated BK channel reduction was associated with an increased MLC(20) phosphorylation level in cultured DSM cells. In summary, PBOO-induced DO is associated with downregulation of BK channel expression in the rabbit model, and this finding can be translated to human BPH patients with DO. Furthermore, downregulation of the BK channel may contribute to DO by increasing the basal level of MLC(20) phosphorylation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study presents the possibilities offered by microfluidic structures for the production of polymeric microspheres, using a process based upon the production of an emulsion. LTCC (Low Temperature Co-fired Ceramics) micromixers have been used for the preparation of polymeric microspheres. The effect of the geometry of the micromixers has been studied, with a specific focus on the size of the microspheres. as well as the control release properties of a model protein loaded within these microspheres. (C) 2008 Published by Elsevier B.V.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of the present substudy of the Lipid Treatment Assessment Project 2 was to assess dual C-reactive protein (CRP) and low-density lipoprotein (LDL) cholesterol goal attainment across a spectrum of low-, moderate-, and high-risk patients with dyslipidemia in 8 countries in North America, Latin America, Europe, and Asia. Of the 9,518 patients studied overall, 45% were women, 64% had hypertension, 31% had diabetes, 14% were current smokers, 60% were high risk, and 79% were taking a statin. The median CRP level was 1.5 mg/L (interquartile range 0.2 to 2.8). On multivariate analysis, higher CRP levels were associated with older age, female gender, hypertension, current smoking, greater body mass index, larger waist circumference, LDL cholesterol level, and triglyceride/high-density lipoprotein cholesterol ratio. In contrast, being from Asia or taking a statin was associated with lower levels. Across all risk groups, 59% of patients attained the CRP target of <2 mg/L, and 33% had <1 mg/L. Overall, 44% of patients attained both their National Cholesterol Education Program Adult Treatment Panel III LDL cholesterol target and a CRP level of <2 mg/L, but only 26% attained their LDL cholesterol target and a CRP level of <1 mg/L. In the very high-risk group with coronary heart disease and >= 2 risk factors, only 19% attained both their LDL cholesterol goal and a CRP level of <2 mg/L and 12% their LDL cholesterol goal and a CRP level of <1 mg/L. In conclusion, with current treatment, most dyslipidemic patients do not reach the dual CRP and LDL cholesterol goals. Smoking cessation, weight reduction, and the greater use of more potent statins at higher doses might be able to improve these outcomes. (C) 2011 Elsevier Inc. All rights reserved. (Am J Cardiol 2011;107:1639-1643)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The myosin-associated giant protein kinases twitchin and titin are composed predominantly of fibronectin- and immunoglobulin-like modules, We report the crystal structures of two autoinhibited twitchin kinase fragments, one from Aplysia and a larger fragment from Caenorhabditis elegans containing an additional C-terminal immunoglobulin-like domain, The structure of the longer fragment shoes that the immunoglobulin domain contacts the protein kinase domain on the opposite side from the catalytic cleft, laterally exposing potential myosin binding residues, Together, the structures reveal the cooperative interactions between the autoregulatory region and the residues from the catalytic domain involved in protein substrate binding, ATP binding, catalysis and the activation loop, and explain the differences between the observed autoinhibitory mechanism and the one found in the structure of calmodulin-dependent kinase I.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The field of protein crystallography inspires and enthrals, whether it be for the beauty and symmetry of a perfectly formed protein crystal, the unlocked secrets of a novel protein fold, or the precise atomic-level detail yielded from a protein-ligand complex. Since 1958, when the first protein structure was solved, there have been tremendous advances in all aspects of protein crystallography, from protein preparation and crystallisation through to diffraction data measurement and structure refinement. These advances have significantly reduced the time required to solve protein crystal structures, while at the same time substantially improving the quality and resolution of the resulting structures. Moreover, the technological developments have induced researchers to tackle ever more complex systems, including ribosomes and intact membrane-bound proteins, with a reasonable expectation of success. In this review, the steps involved in determining a protein crystal structure are described and the impact of recent methodological advances identified. Protein crystal structures have proved to be extraordinarily useful in medicinal chemistry research, particularly with respect to inhibitor design. The precise interaction between a drug and its receptor can be visualised at the molecular level using protein crystal structures, and this information then used to improve the complementarity and thus increase the potency and selectivity of an inhibitor. The use of protein crystal structures in receptor-based drug design is highlighted by (i) HIV protease, (ii) influenza virus neuraminidase and (iii) prostaglandin H-2-synthetase. These represent, respectively, examples of protein crystal structures that (i) influenced the design of drugs currently approved for use in the treatment of HIV infection, (ii) led to the design of compounds currently in clinical trials for the treatment of influenza infection and (iii) could enable the design of highly specific non-steroidal anti-inflammatory drugs that lack the common side-effects of this drug class.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: mild head trauma (MHT) is defined as a transient neurological deficit after trauma with a history of impairment or loss of consciousness lasting less than 15 min and/or posttraumatic amnesia, and a Glasgow Coma Scale between 13 and 15 on hospital admission. We evaluated 50 MHT patients 18 months after the trauma, addressing signs and symptoms of post-concussion syndrome, quality of life and the presence of anxiety and depression. We correlate those findings with the S100B protein levels and cranial CT scan performed at hospital admission after the trauma. Method: patients were asked to fill out questionnaires to assess quality of life (SF36), anxiety and depression (HADS), and signs and symptoms of post-concussion syndrome. For the control group, we asked the patient`s household members, who had no history of head trauma of any type, to answer the same questionnaires for comparison. Results: total quality of life index for patients with MHT was 58.16 (+/-5), lower than the 73.47 (+/-4) presented by the control group. Twenty patients (55.2%) and four (11.1%) controls were depressed. Seventeen patients (47.2%) presented anxiety, whereas only eight (22.2%) controls were considered anxious. Victims of MHT complained more frequently of loss of balance, dry mouth, pain in the arms, loss of memory and dizziness than their respective controls (p < 0.05). We found no correlation between the presence of these signs and symptoms, quality of life, presence of anxiety and depression with S100B protein levels or with presence of injury in the cranial CT performed at hospital admission. Conclusion: MHT is associated with a higher incidence of post-concussion syndrome symptoms, lower quality of life and anxiety than their respective controls even 18 months after the trauma. (C) 2007 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chinese Hamster Ovary (CHO) cells are widely used for the large scale production of recombinant biopharmaceuticals. Growth of the CHO-K1 cell line has been demonstrated in serum-free medium containing insulin, transferrin and selenium. In an attempt to get autocrine growth in protein-free medium, DNA coding for insulin and transferrin production was transfected into CHO-K1 cells. Transferrin was expressed well, with clones secreting approximately 1000 ng/10(6)cells/24h. Insulin was poorly expressed, with rates peaking at 5 ng/10(6)cells/24h. Characterisation of the secreted insulin indicated that the CHO cells were incompletely processing the insulin molecule. Site-directed mutagenesis was used to introduce a furin (prohormone converting enzyme) recognition sequence into the insulin molecule, allowing the production of active insulin. However, the levels were still too low to support autocrine growth. Further investigations revealed insulin degrading activity (presumably due to the presence of insulin degrading enzymes) in the cytoplasm of CHO cells. To overcome these problems insulin-like growth factor I (instead of insulin) was transfected into the cells. IGF-1 was completely processed and expressed at rates greater than 500 ng/10(6)cells/24h. In this paper we report autonomous growth of the transfected CHO-K1 cell line expressing transferrin and IGF-1 in protein-free medium without the addition of exogenous growth factors. Growth rates and final cell densities of these cells were identical to that of the parent cell line CHO-K1 growing in insulin, transferrin, and selenium supplemented serum-free media.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the replication terminator protein (RTP) and DNA terminator sites. While determination of the crystal structure of RTP has facilitated our understanding of how a single RTP dimer interacts with terminator DNA, additional information is required in order to understand the assembly of a functional fork arrest complex, which requires an interaction between two RTP dimers and the terminator site. In this study, we show that the conformation of the major B. subtilis DNA terminator, Terl, becomes considerably distorted upon binding RTP. Binding of the first dimer of RTP to the B site of Terl causes the DNA to become slightly unwound and bent by similar to 40 degrees. Binding of a second dimer of RTP to the A site causes the bend angle to increase to similar to 60 degrees. We have used this new data to construct two plausible models that might explain how the ternary terminator complex can block DNA replication in a polar manner, in the first model, polarity of action is a consequence of the two RTP-DNA half-sites having different conformations. These different conformations result from different RTP-DNA contacts at each half-site (due to the intrinsic asymmetry at the terminator DNA), as well as interactions (direct or indirect) between the RTP dimers on the DNA. In the second model, polar fork arrest activity is a consequence of the different affinities of RTP for the A and B sites of the terminator DNA, modulated significantly by direct or indirect interactions between the RTP dimers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.