Caracterização física e mecânica de argamassas à base de cimento Portland e cinza de casca de arroz residual

Rice husk, employed as an energy source at milling industries in Brazil generates, after burning, a dark ash. This residue is not yet conveniently disposed, being currently dumped on large areas, causing environmental problems. This research intended to evaluate the applications of residual rice husk ashes (RHA) as a partial replacement of cement for mortar production. Rice husk ash was chemically characterized through X-ray fluorescence, determination of carbon content, X-ray diffraction, and laser granulometric analysis. Mortar specimens were submitted to two different exposure conditions: internal and external environments at a maximum period of five months. Physical-mechanical testing were compressive strength and ultrasonic pulse velocity (UPV). Although presenting good mechanical performance, the mortar based on ash (RHA) did not present pozolanicity but it can be employed in cement matrices as inert material (filler).

Germinação e crescimento de Calophyllum brasiliense (Clusiaceae), uma espécie típica de florestas inundadas

Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Caracterização morfoanatômica e histoquímica de Cuphea carthagenensis (Jacq.) J.f. Macbr. (Lythraceae)

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Central retinal vein thrombosis as an initial manifestation of heterozygous protein C deficiency: case report

The purpose of this paper is to report a case of central retinal vein thrombosis associated with isolated heterozygous protein C deficiency. Acute occlusion of the central retinal vein presents as one of the most dramatic pictures in ophthalmology. It is often a result of both local and systemic causes. A rare systemic cause is heterozygous protein C deficiency, and it usually occurs in combination with other thrombophilic conditions. This case highlights that isolated heterozygous protein C deficiency may be the cause of central retinal vein thrombosis and underscores the importance of its screening in young patients with this ophthalmologic disease.

Qualidade de vida de portadores de Diabetes Mellitus tipo II frente às oscilações no nível de atividade física, aspectos socioeconômicos e presença de comorbidades

Universidade Estadual de Campinas . Faculdade de Educação Física

Representação da área de responsabilidade de jogadores de futebol através do Diagrama de Voronoi

Universidade Estadual de Campinas . Faculdade de Educação Física

Em jogo a relação entre pesquisador e clube : futebol e processos grupais

Universidade Estadual de Campinas . Faculdade de Educação Física

Enunciações afetadas : relações possíveis entre homofobia e esporte

Universidade Estadual de Campinas . Faculdade de Educação Física

Cultura de movimento e identidade : a Educação Fisica na contemporaneidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposição e avaliação de um modelo de representação dos membros superiores e escapula durante a marcha humana

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise do processo de rastreamento automatico de jogadores em esportes coletivos

Universidade Estadual de Campinas . Faculdade de Educação Física