Metodologia para re-sintonia de controladores PID industriais

The present work has as objective to present a method of project and implementation of controllers PID, based on industrial instrumentation. An automatic system of auto-tunning of controllers PID will be presented, for systems of first and second order. The software presented in this work is applied in controlled plants by PID controllers implemented in a CLP. Software is applied to make the auto-tunning of the parameters of controller PID of plants that need this tunning. Software presents two stages, the first one is the stage of identification of the system using the least square recursive algorithm and the second is the stage of project of the parameters of controller PID using the root locus algorithm. An important fact of this work is the use of industrial instrumentation for the accomplishment of the experiments. The experiments had been carried through in controlled real plants for controllers PID implemented in the CLP. Thus has not only one resulted obtained with theoreticians experiments made with computational programs, and yes resulted obtained of real systems. The experiments had shown good results gotten with developed software

Uma proposta de metodologia para o ensino de Física usando robótica de baixíssimo custo

This paper presents methodology based on Lev Vigotsky`s social interactionist theory through investigative activities, which integrates the teaching of physics to robotics, directed to students of the Physics degree course, seeking to provide further training for future teachers. The method is organized through educational robotics workshops that addresses concepts of physics through the use of low-cost educational robots along with several activities. The methodology has been presented and discussed and put into practice afterwards in workshops so that these future teachers may be able to take robotics to their classroom. Students from the last and penultimate semester of the Physics degree course of the Federal Institute of Education, Science and Technology of Rio Grande do Norte, Caicó campus participated in this project

Desenvolvimento de métodos construtivos e de novos materiais empregados na confecção de cartuchos de próteses de membros inferiores

The manufacture of prostheses for lower limb amputees (transfemural and transtibial) requires the preparation of a cartridge with appropriate and custom fit to the profile of each patient. The traditional process to the patients, mainly in public hospitals in Brazil, begins with the completion of a form where types of equipment, plugins, measures, levels of amputation etc. are identified. Currently, such work is carried out manually using a common metric tape and caliper of wood to take the measures of the stump, featuring a very rudimentary, and with a high degree of uncertainty geometry of the final product. To address this problem, it was necessary to act in two simultaneously and correlated directions. Originally, it was developed an integrated tool for viewing 3D CAD for transfemoral types of prostheses and transtibial called OrtoCAD I. At the same time, it was necessary to design and build a reader Mechanical equipment (sort of three-dimensional scanner simplified) able to obtain, automatically and with accuracy, the geometric information of either of the stump or the healthy leg. The methodology includes the application of concepts of reverse engineering to computationally generate the representation of the stump and/or the reverse image of the healthy member. The materials used in the manufacturing of prostheses nor always obey to a technical scientific criteria, because, if by one way it meets the criteria of resistance, by the other, it brings serious problems mainly due to excess of weight. This causes to the user various disorders due to lack of conformity. That problem was addressed with the creation of a hybrid composite material for the manufacture of cartridges of prostheses. Using the Reader Fitter and OrtoCAD, the new composite material, which aggregates the mechanical properties of strength and rigidity on important parameters such as low weight and low cost, it can be defined in its better way. Besides, it brings a reduction of up steps in the current processes of manufacturing or even the feasibility of using new processes, in the industries, in order to obtain the prostheses. In this sense, the hybridization of the composite with the combination of natural and synthetic fibers can be a viable solution to the challenges offered above

Painéis-sanduíche com núcleo de EPS reciclado: metodologia de execução e determinação de propriedades termofísicas

New materials made from industrial wastes have been studied as an alternative to traditional fabrication processes in building and civil engineering. These materials are produced considering some issues like: cost, efficiency and reduction of nvironmental damage. Specifically in cases of materials destined to dwellings in low latitude regions, like Brazilian Northeast, efficiency is related to mechanical and thermal resistance. Thus, when thermal insulation and energetic efficiency are aimed, it s important to increase thermal resistance without depletion of mechanical properties. This research was conducted on a construction element made of two plates of cement mortar, interspersed with a plate of recycled expanded polystyrene (EPS). This component, widely known as sandwich-panel, is commonly manufactured with commercial EPS whose substitution was proposed in this study. For this purpose it was applied a detailed methodology that defines parameters to a rational batching of the elements that constitute the nucleus. Samples of recycled EPS were made in two different values of apparent specific mass (ρ = 65 kg/m³; ρ = 130 kg/m³) and submitted to the Quick-Line 30TM that is a thermophysical properties analyzer. Based on the results of thermal conductivity, thermal capacity and thermal diffusivity obtained, it was possible to assure that recycled EPS has thermal insulation characteristics that qualify it to replace commercial EPS in building and civil engineering industry

Metodologia de análise e diagnóstico de fratura em um componente automotivo sujeito a cargas cíclicas alternadas

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Metodologia, Sistema de Codificação e Ferramenta de software para Modelagem de Móveis Modulados

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Preservação de fungos fitopatogênicos habitantes do solo

A preservação de fungos fitopatogênicos por longos períodos de tempo é importante para que pesquisas possam ser realizadas a qualquer momento. Os fungos habitantes do solo são organismos que podem produzir estruturas de resistência em face de situações adversas, tais como ausência de hospedeiros e ou condições climáticas desfavoráveis para a sua sobrevivência. O objetivo deste trabalho foi desenvolver metodologias de preservação de estruturas de resistência para os fungos Fusarium oxysporum f.sp. lycopersici raça 2, Macrophomina phaseolina, Rhizoctonia solani AG4 HGI, Sclerotium rolfsii, Sclerotinia sclerotiorum e Verticillium dahliae. O delineamento foi inteiramente casualizado, com um método de produção de estruturas para cada fungo, submetido a três tratamentos [temperatura ambiente de laboratório (28±2ºC), de geladeira (5ºC) e de freezer (-20ºC)] e com dois frascos por temperatura. Mensalmente, e por um período de um ano, a sobrevivência e o vigor das colônias de cada patógeno foram avaliadas em meios de cultura específicos. Testes de patogenicidade foram realizados após um ano de preservação, com as estruturas que sobreviveram aos melhores tratamentos (temperatura) para todos os fungos. As melhores temperaturas (tratamentos) para preservar os fungos foram: a) F. oxysporum f.sp. lycopersici em temperatura de refrigeração e de freezer (5,2 e 2,9 x 10³ufc.g-1 de talco, respectivamente); b) M. phaseolina em temperatura de refrigeração [100% de sobrevivência (S) e índice 3 de vigor (V)] e S. rolfsii em temperatura ambiente (74,4% S e 1 V) e c) S. sclerotiorum e V. dahliae, ambos em temperatura de freezer (100% S e 3 V). Após um ano de preservação, somente V. dahliae perdeu a patogenicidade na metodologia desenvolvida.

Validação de uma metodologia de ensaio de resistência ao cisalhamento para avaliação da aderência de interfaces revestimento metálico-bainha de cimento aplicada a poços de petróleo

Improving the adherence between oilwell metallic casing and cement sheath potentially decrease the number of corrective actions present/y necessary for Northeastern wells submitted to steam injection. In addition to the direct costs involved in the corrective operations, the economic impact of the failure of the primary cementing aIso includes the loss in the production of the well. The adherence between casing and cement is current/y evaluated by a simple shear tests non standardized by the American Petroleum Institute (API). Therefore, the objective of the present is to propose and evaluate a standardized method to assess the adherence of oilwell metallic casing to cement sheath. To that end, a section of a cemented oilwell was simulated and used to test the effect of different parameters on the shear stress of the system. Surface roughness and different cement compositions submitted or not to thermal cycling were evaluated. The results revealed that the test geometry and parameters proposed yielded different values for the shear stress of the system, corresponding to different adherent conditions between metallic casing and cement sheath

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comparação da precisão dos resultados do teste de tetrazolio usando a metodologia alternativa e a tradicional em sementes de soja

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Aplicação e análise de metodologia de deterioração ambiental em micro-bacia do seridó potiguar

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

A expressão do condicionado contrafactual em construções se p, então q no português brasileiro

Conselho Nacional de Desenvolvimento Científico e Tecnológico

Coenzyme Q(10) and its effects in the treatment of neurodegenerative diseases

According to clinical and pre-clinical studies, oxidative stress and its consequences may be the cause or, at least, a contributing factor, to a large number of neurodegenerative diseases. These diseases include common and debilitating disorders, characterized by progressive and irreversible loss of neurons in specific regions of the brain. The most common neurodegenerative diseases are Parkinson's disease, Huntington's disease, Alzheimer's disease and amyotrophic lateral sclerosis. Coenzyme Q(10) (CoQ(10)) has been extensively studied since its discovery in 1957. It is a component of the electron transportation chain and participates in aerobic cellular respiration, generating energy in the form of adenosine triphosphate (ATP). The property of CoQ(10) to act as an antioxidant or a pro-oxidant, suggests that it also plays an important role in the modulation of redox cellular status under physiological and pathological conditions, also performing a role in the ageing process. In several animal models of neurodegenerative diseases, CoQ(10) has shown beneficial effects in reducing disease progression. However, further studies are needed to assess the outcome and effectiveness of CoQ(10) before exposing patients to unnecessary health risks at significant costs.

Fases e criticalidade no modelo ashkin - teller de três cores

The usual Ashkin-Teller (AT) model is obtained as a superposition of two Ising models coupled through a four-spin interaction term. In two dimension the AT model displays a line of fixed points along which the exponents vary continuously. On this line the model becomes soluble via a mapping onto the Baxter model. Such richness of multicritical behavior led Grest and Widom to introduce the N-color Ashkin-Teller model (N-AT). Those authors made an extensive analysis of the model thus introduced both in the isotropic as well as in the anisotropic cases by several analytical and computational methods. In the present work we define a more general version of the 3-color Ashkin-Teller model by introducing a 6-spin interaction term. We investigate the corresponding symmetry structure presented by our model in conjunction with an analysis of possible phase diagrams obtained by real space renormalization group techniques. The phase diagram are obtained at finite temperature in the region where the ferromagnetic behavior is predominant. Through the use of the transmissivities concepts we obtain the recursion relations in some periodical as well as aperiodic hierarchical lattices. In a first analysis we initially consider the two-color Ashkin-Teller model in order to obtain some results with could be used as a guide to our main purpose. In the anisotropic case the model was previously studied on the Wheatstone bridge by Claudionor Bezerra in his Master Degree dissertation. By using more appropriated computational resources we obtained isomorphic critical surfaces described in Bezerra's work but not properly identified. Besides, we also analyzed the isotropic version in an aperiodic hierarchical lattice, and we showed how the geometric fluctuations are affected by such aperiodicity and its consequences in the corresponding critical behavior. Those analysis were carried out by the use of appropriated definitions of transmissivities. Finally, we considered the modified 3-AT model with a 6-spin couplings. With the inclusion of such term the model becomes more attractive from the symmetry point of view. For some hierarchical lattices we derived general recursion relations in the anisotropic version of the model (3-AAT), from which case we can obtain the corresponding equations for the isotropic version (3-IAT). The 3-IAT was studied extensively in the whole region where the ferromagnetic couplings are dominant. The fixed points and the respective critical exponents were determined. By analyzing the attraction basins of such fixed points we were able to find the three-parameter phase diagram (temperature £ 4-spin coupling £ 6-spin coupling). We could identify fixed points corresponding to the universality class of Ising and 4- and 8-state Potts model. We also obtained a fixed point which seems to be a sort of reminiscence of a 6-state Potts fixed point as well as a possible indication of the existence of a Baxter line. Some unstable fixed points which do not belong to any aforementioned q-state Potts universality class was also found