Avaliação sorológica de Parainfluenzavirus Tipo 1, Salmonella spp., Mycoplasma spp. e Toxoplasma gondii em aves silvestres

Newcastle disease, salmonellosis and mycoplamosis are the most important infectious diseases in poultry. Toxoplamosis is a common disease in urban environment. The present study investigated serologic evidence of these diseases in captive and wildlife birds, with rapid plate agglutination test, haemagglutination inhibition test, and modified agglutination test. In a total of 117 blood serum samples, 20 showed the presence of Toxoplasma gondii, Mycoplasma gallisepticum, and Salmonella spp. antibodies. Amazona aestiva was the specie with the highest number of positive individuals (13/20). We also verified the first detection of T. gondii antibodies in birds of prey from Mivalgo chimachima and Rupornis magnirostris species.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Detecção sorológica e molecular de Anaplasma marginale em búfalos na Ilha de Marajó, Pará

The aim of the study was to test the molecular and serological prevalence of Anaplasma marginale in water buffaloes of the Marajó Island, State of Pará, Brazil. For serologic research were randomly selected 800 buffaloes and for molecular research 50 of these animals were randomly chosen. To quantify the serological prevalence we used the indirect enzyme linked immunosorbent assay (iELISA) with total antigen containing proteins outer surface. To quantify the prevalence molecular was used the polymerase chain reaction (PCR) involving gene amplification fragment larger surface protein 5 (MSP5). The prevalence of positive animals in iELISA was 25% (200/800). In the PCR we detected the presence of A. marginale in 2% (1/50) of animals. Although only one animal was positive in PCR, we found that it was negative in ELISA. The presence of the agent, even in low prevalence, shows that buffaloes can act as an important reservoir for transmission of the pathogen to cattle in northern Brazil.

Staphylococcus epidermis e Staphylococcus haemolycus: detecção de genes de biofilme, toxinas, resistência a antimicrobianos e tipagem clonal em isolados de hemoculturas

Pós-graduação em Biologia Geral e Aplicada - IBB

Detecção do operon ica da produção de biofilme, gene mecA de resistência à oxacilina e identificação de espécies de Staphylococcus spp. diretamente dos frascos de hemoculturas pela técnica de PCR multiplex

Pós-graduação em Doenças Tropicais - FMB

Detecção dos genes de virulência e identificação do perfil clonal de isolados de Staphylococcus aureus colonizantes de nasofaringe otbtidos em estudo de base populacional

Pós-graduação em Doenças Tropicais - FMB

Influência da fixação e de métodos de secagem na detecção de alterações proliferativas ultraestruturais induzidas pelo Diuron no urotélio vesical de ratos wistar

Pós-graduação em Patologia - FMB

Desenvolvimento de biossensor baseado em extrato de açaí e sensor biomimético para detecção de hexazinona

Pós-graduação em Química - IQ

Imunossensores à base de filmes nanoestruturados de fibroína da seda - peptídeo antigênico NS5A-1-vanadato de ítrio: európio para detecção de Hepatite C

Pós-graduação em Química - IQ

Diversidade de bemisia tabaci na américa latina e detecção de seus endossimbiontes

Pós-graduação em Agronomia (Proteção de Plantas) - FCA

Detecção e localização de danos em materiais compósitos aplicado em aeronaves utilizando redes neurais artificiais

Pós-graduação em Engenharia Mecânica - FEIS

Novas configurações de interferômetros de quadratura e de técnicas de detecção de fase óptica baseadas em phase unwrapping

Pós-graduação em Engenharia Elétrica - FEIS

Estudo de sensores PZT aplicados à detecção de danos em tubulações

Pós-graduação em Engenharia Elétrica - FEIS

Desempenho de escolares de ensino público com e sem dificuldade de aprendizagem em habilidadefonológica, nomeação rápida, leitura e escrita

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Desenvolvimento de biossensor eletroquímico para diagnóstico de dengue

Pós-graduação em Biotecnologia - IQ