The Unexpected Preference for the fac-Isomer with the Tris(5-ester-substituted-2,2′-bipyridine) Complexes of Ruthenium(II)

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

The isolation and secondary functionalisation of fac-tris2,2'-bipyridine complexes of ruthenium(II)

Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.

The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

La relación de las exequías de Carlos III en Roma y el nuevo gusto neoclásico

El fallecimiento de Carlos III en diciembre de 1788 fue conmemorado en la Roma de Pío VI con unas exequias oficiales españolas organizadas por el embajador José Nicolás de Azara y por un funeral ordenado por el Papa. Azara aprovechó la ocasión para materializar en dicha función fúnebre sus radicales principios neoclásicos. Paralelamente, ambas ceremonias efímeras se fijaron mediante una serie de lujosas publicaciones en las que intervino decisivamente el impresor más característico del Neoclasicismo: Gimbattista Bodoni. Las exequias de Carlos III en Roma fueron la obra de un intelectual. Son producto de la Roma cosmopolita de los años ochenta del siglo XVIII, foco de atracción para artistas, aficionados, coleccionistas e inteligentes en las artes.

Electron collisions with Fe-peak elements: Forbidden transitions between the low lying valence states 3d6, 3d54s, and 3d54p of Fe III:

Effective collision strengths are presented for the Fe-peak element Fe III at electron temperatures (Te in degrees Kelvin) in the range 2 × 103 to 1 × 106. Forbidden transitions results are given between the 3d6, 3d54s, and the 3d54p manifolds applicable to the modeling of laboratory and astrophysical plasmas.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

High-resolution spectroscopic observations of B-type stars from the Edinburgh-Cape Survey - III. Completion of a magnitude range limited survey

High spectral resolution (R similar to 40 000) and signal-to- noise ratio observations of five high Galactic latitude early- type stars taken from the Edinburgh-Cape (EC) Faint Blue Object Survey are presented. These were required to complete a magnitude range-limited survey of young B-type objects with 11 <V <15. Of the five stars, four were rejected on the grounds that they are either subluminous (subdwarf or horizontal branch), were part of a binary system or possessed colours later than the (U - B) = -0.5 cut-off employed. The remaining star in the data set, EC 19596-5356, is found to exhibit normal young B-type stellar properties. A kinematic analysis reveals that an origin in the Galactic disc appears likely for all the stars in the sample. Some statistics are drawn about the number density of young stars in the Galactic halo.