Calcium absorption in postmenopausal osteoporosis: Benefit of HRT plus calcitriol, but not HRT alone, in both malabsorbers and normal absorbers

In a randomized trial involving 71 postmenopausal osteoporotic women with vertebral compression fractures, radiocalcium absorption studies using the Ca-45 single isotope method (alpha) were performed at baseline and after 8 months of treatment with either continuous combined hormone replacement therapy (HRT, as piperazine estrone sulfate 0.625-0.937mg daily +/- medroxyprogesterone acetate 2.5 mg daily depending on uterine status) or HRT plus calcitriol 0.25 mu g twice daily. A calcium supplement of 600 mg nocte was given to only those women who had a daily calcium intake of less than 1 g per day at baseline, as assessed by recalled dietary intake. There was a significant decrease 0.74 (+/- 0.35 SD) to 0.58 (+/- 0.22), Delta alpha = -0.17 (+/- 0.26), p<0.0005] in alpha at 8 months compared with baseline in the HRT-treated group, but a significant increase [0.68 (+/- 0.31) to 0.84 (+/- 0.27), Delta alpha = +0.16 (+/- 0.30), p<0.003] in the HRT-plus-calcitriol treated patients, resulting in alpha being significantly higher after 8 months in the latter group than in the HRT-only group. Although 72% of the patients had been supplemented with calcium between the first and second studies, separate analyses revealed that the change in calcium intake had not affected the result. Further breakdown of the groups into baseline 'normal' absorbers (alpha greater than or equal to 0.55) and 'malabsorbers' (alpha <0.55) revealed that alpha decreased with HRT treatment only in the normal absorbers, and remained stable in the malabsorbers. Conversely, following HRT plus calcitriol treatment, alpha increased only in the malabsorbers, the normal absorbers in this group remaining unchanged. In conclusion, our data show that HRT, of the type and dose used in this study, did not produce an increase in absorption efficiency; it was in fact associated with a fall. increased absorption efficiency cannot be achieved unless calcitriol is used concurrently, and then only in patients with malabsorption. Calcitriol also had a significant effect in normal absorbers in that it prevented the decline in alpha seen with HRT alone, and thus should be considered in all patients with postmenopausal osteoporosis treated with HRT.

The VITATOPS (vitamins to prevent stroke) Trial: Rationale and design of an international, large, simple, randomised trial of homocysteine-lowering multivitamin therapy in patients with recent transient ischaemic attack or stroke

Background: Epidemiological studies suggest that raised plasma concentrations of total homocysteine (tHcy) may be a common, causal and treatable risk factor for atherothromboembolic ischaemic stroke. Although tHcy can be lowered effectively with small doses of folic acid, vitamin B-12 and vitamin B-6, it is not known whether lowering tHcy, by means of multivitamin therapy, can prevent stroke and other major atherothromboembolic vascular events. Purpose: To determine whether vitamin supplements (folic acid 2 mg, B-6 25 Mg, B-12 500 mug) reduce the risk of stroke, and other serious vascular events, in patients with recent stroke or transient ischaemic attacks of the brain or eye (TIA). Methods: An international, multi-centre, randomised, double-blind, placebo-controlled clinical trial. Results: As of November 2001, more than 1,400 patients have been randomised from 10 countries in four continents. Conclusion: VITATOPS aims to recruit and follow up 8,000 patients between 2000 and 2004, and provide a reliable estimate of the safety and effectiveness of dietary supplementation with folic acid, vitamin B-12, and vitamin B-6 in reducing recurrent serious vascular events among a wide range of patients with TIA and stroke. Copyright (C) 2002 S. Karger AG, Basel.

Characterization of pore wall heterogeneity in nanoporous carbons using adsorption: the slit pore model revisited

In this paper, we propose a new nonlocal density functional theory characterization procedure, the finite wall thickness model, for nanoporous carbons, whereby heterogeneity of pore size and pore walls in the carbon is probed simultaneously. We determine the pore size distributions and pore wall thickness distributions of several commercial activated carbons and coal chars, with good correspondence with X-ray diffraction. It is shown that the conventional infinite wall thickness approach overestimates the pore size slightly. Pore-pore correlation has been shown to have a negligible effect on prediction of pore size and pore wall thickness distributions for small molecules such as argon used in characterization. By utilizing the structural parameters (pore size and pore wall thickness distribution) in the generalized adsorption isotherm (GAI) we are able to predict adsorption uptake of supercritical gases in BPL and Norit RI Extra carbons, in excellent agreement with experimental adsorption uptake data up to 60 MPa. The method offers a useful technique for probing features of the solid skeleton, hitherto studied by crystallographic methods.

The alpha-galactosyl derivatives of ganglioside GD(1b) are essential for the organization of lipid rafts in RBL-2H3 mast cells

Gangliosides are complex glycosphingolipids that are important in many biological processes. The present study investigated the role of gangliosides in the organization of lipid rafts in RBL-2H3 mast cells and in the modulation of mast cell degranulation via Fc epsilon RI. The role of gangliosides was examined using two ganglioside deficient cell lines (B6A4A2III-E5 and B6A4C1III-D1) as well as the parent cell line (RBL-2H3). All three cell lines examined express Fc epsilon RI, Lyn, Syk and LAT. However, only in RBL-2H3 cells were Fc epsilon RI, LAT and alpha-galactosyl derivatives of ganglioside GD(1b) mobilized to lipid raft domains following Fc epsilon RI stimulation. The inhibition of glycosphingolipid synthesis in RBL-2H3 cells also resulted in a decrease in the release of beta-hexosaminidase activity after Fc epsilon RI activation. The two mutant cell lines have a reduced release of beta-hexosaminidase activity after Fc epsilon RI stimulation, but not after exposure to calcium ionophore. These results indicate that the alpha-galactosyl derivatives of ganglioside GD(1b) are important in the initial events of Fc epsilon RI signaling upstream of Ca(2+) influx. Since the initial signaling events occur in lipid rafts and in the mutant cell lines the rafts are disorganized, these results also suggest that these gangliosides contribute to the correct assembly of lipid rafts and are essential for mast cell activation via Fc epsilon RI. (c) 2008 Published by Elsevier Inc.

Mechanism of ribonuclease inhibition by ribonuclease inhibitor protein based on the crystal structure of its complex with ribonuclease A

We describe the mechanism of ribonuclease inhibition by ribonuclease inhibitor, a protein built of leucine-rich repeats, based on the crystal structure of the complex between the inhibitor and ribonuclease A. The structure was determined by molecular replacement and refined to an R(cryst) of 19.4% at 2.5 Angstrom resolution. Ribonuclease A binds to the concave region of the inhibitor protein comprising its parallel beta-sheet and loops. The inhibitor covers the ribonuclease active site and directly contacts several active-site residues. The inhibitor only partially mimics the RNase-nucleotide interaction and does not utilize the pi phosphate-binding pocket of ribonuclease A, where a sulfate ion remains bound. The 2550 Angstrom(2) of accessible surface area buried upon complex formation may be one of the major contributors to the extremely tight association (K-i = 5.9 x 10(-14) M). The interaction is predominantly electrostatic; there is a high chemical complementarity with 18 putative hydrogen bonds and salt links, but the shape complementarity is lower than in most other protein-protein complexes. Ribonuclease inhibitor changes its conformation upon complex formation; the conformational change is unusual in that it is a plastic reorganization of the entire structure without any obvious hinge and reflects the conformational flexibility of the structure of the inhibitor. There is a good agreement between the crystal structure and other biochemical studies of the interaction. The structure suggests that the conformational flexibility of RI and an unusually large contact area that compensates for a lower degree of complementarity may be the principal reasons for the ability of RI to potently inhibit diverse ribonucleases. However, the inhibition is lost with amphibian ribonucleases that have substituted most residues corresponding to inhibitor-binding residues in RNase A, and with bovine seminal ribonuclease that prevents inhibitor binding by forming a dimer. (C) 1996 Academic Press Limited

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pirellulosomes: A new type of membrane-bounded cell compartment in planctomycete bacteria of the genus Pirellula

A distinct type of cellular organization was found in two species of the planctomycete genus Pirellula, Pirellula marina and Pirellula staleyi. Both species possess two distinct regions within the cell which are separated by a single membrane. The major region of the cell, the pirellulosome, contains the fibrillar condensed nucleoid. The other area, the polar cap region, forms a continuous layer surrounding the entire pirellulosome and displays a cap of asymmetrically distributed material at one cell pole. Immuno- and cytochemical-labelling of P. marina demonstrated that DNA is located exclusively within the pirellulosome; cell RNA is concentrated in the pirellulosome, with some RNA also located in the polar cap region.

Autoimmunity in IgA deficiency: Revisiting the role of IgA as a silent housekeeper

Both systemic and organ-specific autoimmune diseases are major manifestations of IgA deficiency (IgAD), the most common primary immunodeficiency. In addition, to discuss the clinical findings of IgAD patients, we proposed a hypothesis to explain the high association with autoimmune phenomena. Based on observations, interactions of monomeric IgA with Fc alpha RI result in a partial phosphorylation of FcR gamma-associated FcaRI, notably in the immunoreceptor tyrosine-based activation motif (ITAM) inducing the recruitment of the SHP-1 tyrosine phosphatase. This leads to deactivation of several activating pathways of the immune system including immunoreceptors that bear ITAM motif and ITAM-independent receptors. Consequently, inflammatory reactions and auto-immune process would be prevented.

Eosinophils in bronchial mucosa of asthmatics after allergen challenge: effect of anti-IgE treatment

Anti-IgE, omalizumab, inhibits the allergen response in patients with asthma. This has not been directly related to changes in inflammatory conditions. We hypothesized that anti-IgE exerts its effects by reducing airway inflammation. To that end, the effect of anti-IgE on allergen-induced inflammation in bronchial biopsies in 25 patients with asthma was investigated in a randomized, double-blind, placebo-controlled study. Allergen challenge followed by a bronchoscopy at 24 h was performed at baseline and after 12 weeks of treatment with anti-IgE or placebo. Provocative concentration that causes a 20% fall in forced expiratory volume in 1 s (PC(20)) methacholine and induced sputum was performed at baseline, 8 and 12 weeks of treatment. Changes in the early and late responses to allergen, PC(20), inflammatory cells in biopsies and sputum were assessed. Both the early and late asthmatic responses were suppressed to 15.3% and 4.7% following anti-IgE treatment as compared with placebo (P < 0.002). This was paralleled by a decrease in eosinophil counts in sputum (4-0.5%) and postallergen biopsies (15-2 cells/0.1 mm(2)) (P < 0.03). Furthermore, biopsy IgE+ cells were significantly reduced between both the groups, whereas high-affinity IgE receptor and CD4+ cells were decreased within the anti-IgE group. There were no significant differences for PC(20) methacholine. The response to inhaled allergen in asthma is diminished by anti-IgE, which in bronchial mucosa is paralleled by a reduction in eosinophils and a decline in IgE-bearing cells postallergen without changing PC(20) methacholine. This suggests that the benefits of anti-IgE in asthma may be explained by a decrease in eosinophilic inflammation and IgE-bearing cells.

Activated status of basophils in chronic urticaria leads to interleukin-3 hyper-responsiveness and enhancement of histamine release induced by anti-IgE stimulus

Background Basophils and mast cells are the main target cells in chronic idiopathic urticaria (CIU). Besides the basopenia, intrinsic defects of the anti-IgE cross-linking signalling pathway of basophils have been described in CIU. Objectives We sought to investigate the profile of expression of activation markers on basophils of patients with CIU and to explore the effect of interleukin (IL)-3 priming upon anti-IgE cross-linking stimuli through expression of activation markers and basophil histamine releasability. Methods Evaluation of the surface expression of Fc epsilon RI alpha, CD63, CD203c and CD123 on whole blood basophils of patients with CIU undergoing autologous serum skin test (ASST) was performed by flow cytometry. The effect of pretreatment with IL-3 in the anti-IgE response was analysed by the expression of basophil activation markers and histamine release using enzyme-linked immunosorbent assay. Results Blood basophils of patients with CIU were reduced in number and displayed increased surface expression of Fc epsilon RI alpha, which was positively correlated with the IgE serum levels. Upregulation of expression of both surface markers CD203c and CD63 was verified on basophils of patients with CIU, regardless of ASST response. High expression of IL-3 receptor on basophils was detected only in ASST+ patients with CIU. Pretreatment with IL-3 upregulated CD203c expression concomitantly with the excreting function of blood basophils and induced a quick hyper-responsiveness to anti-IgE cross-linking on basophils of patients with CIU compared with healthy controls. Conclusions Basophils of patients with CIU showed an activated profile, possibly due to an in vivo priming. Functionally, basophils have high responsiveness to IL-3 stimulation, thereby suggesting that defects in the signal transduction pathway after IgE cross-linking stimuli are recoverable in subjects with chronic urticaria.

Mast cell-associated alveolar inflammation in patients with atopic uncontrolled asthma

Background: A significant proportion of patients with asthma have persistent symptoms despite treatment with inhaled glucocorticosteroids. Objective: We hypothesized that in these patients, the alveolar parenchyma is subjected to mast cell-associated alterations. Methods: Bronchial and transbronchial biopsies from healthy controls (n = 8), patients with allergic rhinitis (n = 8), and patients with atopic uncontrolled asthma (symptoms despite treatment with inhaled glucocorticosteroids; mean dose, 743 mu g/d; n = 14) were processed for immunohistochemical identification of mast cell subtypes and mast cell expression of Fc epsilon RI and surface-bound IgE. Results: Whereas no difference in density of total bronchial mast cells was observed between patients with asthma and healthy controls, the total alveolar mast cell density was increased in the patients with asthma (P < .01). Division into mast cell subtypes revealed that in bronchi of patients with asthma, tryptase positive mast cells (MC(T)) numbers decreased compared with controls (P <= .05), whereas tryptase and chymase positive mast cells (MC(TC)) increased (P <= .05). In the alveolar parenchyma from patients with asthma, an increased density was found for both MC(T) (P <= .05) and MC(TC) (P <= .05). The increased alveolar mast cell densities were paralleled by an increased mast cell expression of FceRI (P < .001) compared with the controls. The patients with asthma also had increased numbers (P < .001) and proportions (P < .001) of alveolar mast cells with surface-bound IgE. Similar increases in densities, FceRI expression, and surface-bound IgE were not seen in separate explorations of alveolar mast cells in patients with allergic rhinitis. Conclusion: Our data suggest that patients with atopic uncontrolled asthma have an increased parenchymal infiltration of MCT and MCTC populations with increased expression of FceRI and surface-bound IgE compared with atopic and nonatopic controls. (J Allergy Clin Immunol 2011;127:905-12.)

Dobutamine Stress Echocardiography in Heart Transplant Recipients` Evaluation: The Role of Reinnervation

Introduction. Orthotopic heart transplantation renders the recipient denervated. This remodeling of the intrinsic cardiac nervous system should be taken in account during functional evaluation for allograft coronary artery disease. Dobutamine stress echocardiography (DSE) has been used to detect patients at greater risk. The aim of this study was to determine whether patients with various autonomic response levels, and supposed reinnervation patterns, show the same response to DSE. Methods. We studied 20 patients who had survived more than 5 years after orthotopic heart transplantation. All patients underwent a Holter evaluation. We considered patients with low variability to be those with less than a 40-bpm variation from the lowest to highest heart rate, so-called ""noninnenervated"" (group NI). Patients who had 40-bpm or more variation were considered to show high variability and called ""reinnervated"" (group RI). After that, all patients performed an ergometric test and DSE. Results. Groups were defined as NI (n = 9) and RI (n = 11). Ergometric tests confirmed this response with NI patients showing less variability when compared to RI patients (P = .0401). During DSE, patients showed similar median heart rate responses according to the dobutamine dose. Spearmen correlation showed r = 1.0 (P = .016). Conclusions: DES was effective to reach higher heart rates, probably related to catecholamine infusion. These findings may justify a better response when evaluating cardiac allograft vasculopathy in heart transplant patients.

Tyrosines in the Carboxyl Terminus Regulate Syk Kinase Activity and Function

The Syk tyrosine kinase family plays an essential role in immunoreceptor tyrosine-based activation motif (ITAM) signaling. The binding of Syk to tyrosine-phosphorylated ITAM subunits of immunoreceptors, such as Fc epsilon RI on mast cells, results in a conformational change, with an increase of enzymatic activity of Syk. This conformational change exposes the COOH-terminal tail of Syk, which has three conserved Tyr residues (Tyr-623, Tyr-624, and Tyr-625 of rat Syk). To understand the role of these residues in signaling, wild-type and mutant Syk with these three Tyr mutated to Phe was expressed in Syk-deficient mast cells. There was decreased Fc epsilon RI-induced degranulation, nuclear factor for T cell activation and NF kappa B activation with the mutated Syk together with reduced phosphorylation of MAP kinases p38 and p42/44 ERK. In non-stimulated cells, the mutated Syk was more tyrosine phosphorylated predominantly as a result of autophosphorylation. In vitro, there was reduced binding of mutated Syk to phosphorylated ITAM due to this increased phosphorylation. This mutated Syk from non-stimulated cells had significantly reduced kinase activity toward an exogenous substrate, whereas its autophosphorylation capacity was not affected. However, the kinase activity and the autophosphorylation capacity of this mutated Syk were dramatically decreased when the protein was dephosphorylated before the in vitro kinase reaction. Furthermore, mutation of these tyrosines in the COOH-terminal region of Syk transforms it to an enzyme, similar to its homolog ZAP-70, which depends on other tyrosine kinases for optimal activation. In testing Syk mutated singly at each one of the tyrosines, Tyr-624 but especially Tyr-625 had the major role in these reactions. Therefore, these results indicate that these tyrosines in the tail region play a critical role in regulating the kinase activity and function of Syk.

Gangliosides Are Important for the Preservation of the Structure and Organization of RBL-2H3 Mast Cells

Gangliosides are known to be important in many biological processes. However, details concerning the exact function of these glycosphingolipids in cell physiology are poorly understood. in this study, the role of gangliosides present on the surface of rodent mast cells in maintaining cell structure was examined using RBL-2H3 mast cells and two mutant cell lines (E5 and D1) deficient in the gangliosides, GM(1) and the alpha-galactosyl derivatives of the ganglioside GD(1b). The two deficient cell lines were morphologically different from each other as well as from the parental RBL-2H3 cells. Actin filaments in RBL-2H3 and E5 cells were under the plasma membrane following the spindle shape of the cells, whereas in D1 cells, they were concentrated in large membrane ruffles. Microtubules in RBL-2H3 and E5 cells radiated from the centrosome and were organized into long, straight bundles. The bundles in D1 cells were thicker and organized circumferentially under the plasma membrane. The endoplasmic reticulum, the Golgi complex, and the secretory granule matrix were also altered in the mutant cell lines. These results suggest that the mast cell-specific alpha-galactosyl derivatives of ganglioside GD(1b) and GM(1) are important in maintaining normal cell morphology. (J Histochern Cytochem 58:83-93, 2010)

A method for simultaneous detection and identification of Brazilian dog- and vampire bat-related rabies virus by reverse transcription loop-mediated isothermal amplification assay

At present, the sporadic occurrence of human rabies in Brazil can be attributed primarily to dog- and vampire bat-related rabies viruses. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) was employed as a simultaneous detection method for both rabies field variants within 60 min. Vampire bat-related rabies viruses could be distinguished from dog variants by digesting amplicons of the RT-LAMP reaction using the restriction enzyme Alwl. Amplification and digestion could both be completed within 120 min after RNA extraction. In addition, the RI-LAMP assay also detected rabies virus in isolates from Brazilian frugivorous bats and Ugandan dog, bovine and goat samples. In contrast, there were false negative results from several Brazilian insectivorous bats and all of Chinese dog, pig, and bovine samples using the RI-LAMP assay. This study showed that the RT-LAMP assay is effective for the rapid detection of rabies virus isolates from the primary reservoir in Brazil. Further improvements are necessary so that the RT-LAMP assay can be employed for the universal detection of genetic variants of rabies virus in the field. (C) 2010 Elsevier B.V. All rights reserved.