999 resultados para Padronização de Processos
Resumo:
The using of supervision systems has become more and more essential in accessing, managing and obtaining data of industrial processes, because of constant and frequent developments in industrial automation. These supervisory systems (SCADA) have been widely used in many industrial environments to store process data and to control the processes in accordance with some adopted strategy. The SCADA s control hardware is the set of equipments that execute this work. The SCADA s supervision software accesses process data through the control hardware and shows them to the users. Currently, many industrial systems adopt supervision softwares developed by the same manufacturer of the control hardware. Usually, these softwares cannot be used with other equipments made by distinct manufacturers. This work proposes an approach for developing supervisory systems able to access process information through different control hardwares. An architecture for supervisory systems is first defined, in order to guarantee efficiency in communication and data exchange. Then, the architecture is applied in a supervisory system to monitor oil wells that use distinct control hardwares. The implementation was modeled and verified by using the formal method of the Petri networks. Finally, experimental results are presented to demonstrate the applicability of the proposed solution
Resumo:
Operating industrial processes is becoming more complex each day, and one of the factors that contribute to this growth in complexity is the integration of new technologies and smart solutions employed in the industry, such as the decision support systems. In this regard, this dissertation aims to develop a decision support system based on an computational tool called expert system. The main goal is to turn operation more reliable and secure while maximizing the amount of relevant information to each situation by using an expert system based on rules designed for a particular area of expertise. For the modeling of such rules has been proposed a high-level environment, which allows the creation and manipulation of rules in an easier way through visual programming. Despite its wide range of possible applications, this dissertation focuses only in the context of real-time filtering of alarms during the operation, properly validated in a case study based on a real scenario occurred in an industrial plant of an oil and gas refinery
Resumo:
Slugging is a well-known slugging phenomenon in multiphase flow, which may cause problems such as vibration in pipeline and high liquid level in the separator. It can be classified according to the place of its occurrence. The most severe, known as slugging in the riser, occurs in the vertical pipe which feeds the platform. Also known as severe slugging, it is capable of causing severe pressure fluctuations in the flow of the process, excessive vibration, flooding in separator tanks, limited production, nonscheduled stop of production, among other negative aspects that motivated the production of this work . A feasible solution to deal with this problem would be to design an effective method for the removal or reduction of the system, a controller. According to the literature, a conventional PID controller did not produce good results due to the high degree of nonlinearity of the process, fueling the development of advanced control techniques. Among these, the model predictive controller (MPC), where the control action results from the solution of an optimization problem, it is robust, can incorporate physical and /or security constraints. The objective of this work is to apply a non-conventional non-linear model predictive control technique to severe slugging, where the amount of liquid mass in the riser is controlled by the production valve and, indirectly, the oscillation of flow and pressure is suppressed, while looking for environmental and economic benefits. The proposed strategy is based on the use of the model linear approximations and repeatedly solving of a quadratic optimization problem, providing solutions that improve at each iteration. In the event where the convergence of this algorithm is satisfied, the predicted values of the process variables are the same as to those obtained by the original nonlinear model, ensuring that the constraints are satisfied for them along the prediction horizon. A mathematical model recently published in the literature, capable of representing characteristics of severe slugging in a real oil well, is used both for simulation and for the project of the proposed controller, whose performance is compared to a linear MPC
Resumo:
There is a growing need to develop new tools to help end users in tasks related to the design, monitoring, maintenance and commissioning of critical infrastructures. The complexity of the industrial environment, for example, requires that these tools have flexible features in order to provide valuable data for the designers at the design phases. Furthermore, it is known that industrial processes have stringent requirements for dependability, since failures can cause economic losses, environmental damages and danger to people. The lack of tools that enable the evaluation of faults in critical infrastructures could mitigate these problems. Accordingly, the said work presents developing a framework for analyzing of dependability for critical infrastructures. The proposal allows the modeling of critical infrastructure, mapping its components to a Fault Tree. Then the mathematical model generated is used for dependability analysis of infrastructure, relying on the equipment and its interconnections failures. Finally, typical scenarios of industrial environments are used to validate the proposal
Resumo:
Particularly in Braziland in Rio Grande do Norte, companies manufacturing red ceramic, play an important role as agents of development to study the region Seridó- RN, specific place for carrying out the research. It is observed in this region a concentration of red ceramic industries of small size, which, despite its importance in the ceramic, they are unable to enjoy or use the new forms of administrative management and technological advances designed and offered by universities, centers of research and projects of governments, remained almost entirely outside the progress and modernization, technological and administrative. These companies still have outdated technology, and management processes, providing quality problems and standardization of end products. Upon these conditions are the companies going through crisis and struggling to survive alone and without assistance. The region of Seridó-RN, lets make a detailed case study of red ceramic companies in the region proposed from the existing theoretical and actual lifting of the condition of the product manufacturing red ceramic, allowing through this overview of the implementation of collect samples of raw materials, allowing the study of each ceramic industry that contributed to the participation of the research, which was determined parameters such as: analysis of the physical, chemical and technological properties of raw materials, characterization of the processes used, raising the technological resources considering equipment, machinery, supplies, raw materials and facilities available and its organization by type of products from companies involved in this study. The methodology consists of the following steps: collection of raw material, crushing and screening, characterization of raw materials (liquid limit, chemical analysis, mineralogical analysis, differential thermal analysis, sieve analysis), mixing, forming, cutting, drying and burning of ceramic bodies and bodies of evidence. The results showed that it was clay with distinct characteristics with respect to plasticity. With respect to the different compositions of mixtures of ceramic masses, we conclude that the ceramic properties showed a direct proportionality with increasing fraction of the clay not plastic. However, the compositions of the masses studied proved to be the most appropriate for the types of simulated clay for use in ceramics. Adopted in the ceramic processing made it possible to obtain products the resulted in consistent properties, and in some cases even exceeding the requirements of technical studies and standard-Brazilian clays to obtain ceramic products such as tiles, bricks and tiles to floor. Based on the discussions from the results obtained in the various processing steps of this work, one can draw conclusions according to the physico-chemical and mineralogical properties of raw materials, the properties of ceramic products burned and analysis. This work may be used by other researchers, private companies and governmental organizations, undergraduate students and graduate, can develop studies and future research to: develop projects to modify the furnaces; mapping projects develop and rationalize the exploitation of raw materials ;promoting reforestation and forest management; develop reduction projects and recovery of waste; develop training projects in manpower sector, and develop security projects, improving the conditions of work in the area pottery
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The generation of wastes in most industrial process is inevitable. In the petroleum industry, one of the greatest problems for the environment is the huge amount of produced water generated in the oil fields. This wastewater is a complex mixture and present great amounts. These effluents can be hazardous to the environmental without adequate treatment. This research is focused in the analysis of the efficiencies of the flotation and photo-oxidation processes to remove and decompose the organic compounds present in the produced water. A series of surfactants derivated from the laurilic alcohol was utilized in the flotation to promote the separation. The experiments have been performed with a synthetic wastewater, carefully prepared with xylene. The experimental data obtained using flotation presented a first order kinetic, identified by the quality of the linear data fitting. The best conditions were found at 0.029 g.L-1 for the surfactant EO 7, 0.05 g.L-1 for EO 8, 0.07 g.L-1 for EO 9, 0.045 g.L-1 for EO 10 and 0.08 g.L-1 for EO 23 with the following estimated kinetic constants: 0.1765, 0.1325, 0.1210, 0.1531 and 0.1699 min-1, respectively. For the series studied, the most suitable surfactant was the EO 7 due to the lower reagent onsumption, higher separation rate constant and higher removal efficiency of xylene in the aqueous phase (98%). Similarly to the flotation, the photo-Fenton process shows to be efficient for degradation of xylene and promoting the mineralization of the organic charge around 90% and 100% in 90 min
Resumo:
A chemical process optimization and control is strongly correlated with the quantity of information can be obtained from the system. In biotechnological processes, where the transforming agent is a cell, many variables can interfere in the process, leading to changes in the microorganism metabolism and affecting the quantity and quality of final product. Therefore, the continuously monitoring of the variables that interfere in the bioprocess, is crucial to be able to act on certain variables of the system, keeping it under desirable operational conditions and control. In general, during a fermentation process, the analysis of important parameters such as substrate, product and cells concentration, is done off-line, requiring sampling, pretreatment and analytical procedures. Therefore, this steps require a significant run time and the use of high purity chemical reagents to be done. In order to implement a real time monitoring system for a benchtop bioreactor, these study was conducted in two steps: (i) The development of a software that presents a communication interface between bioreactor and computer based on data acquisition and process variables data recording, that are pH, temperature, dissolved oxygen, level, foam level, agitation frequency and the input setpoints of the operational parameters of the bioreactor control unit; (ii) The development of an analytical method using near-infrared spectroscopy (NIRS) in order to enable substrate, products and cells concentration monitoring during a fermentation process for ethanol production using the yeast Saccharomyces cerevisiae. Three fermentation runs were conducted (F1, F2 and F3) that were monitored by NIRS and subsequent sampling for analytical characterization. The data obtained were used for calibration and validation, where pre-treatments combined or not with smoothing filters were applied to spectrum data. The most satisfactory results were obtained when the calibration models were constructed from real samples of culture medium removed from the fermentation assays F1, F2 and F3, showing that the analytical method based on NIRS can be used as a fast and effective method to quantify cells, substrate and products concentration what enables the implementation of insitu real time monitoring of fermentation processes
Resumo:
The petroleum industry deals with problems which are difficult to solve because of their relation to environmental issues. This is because amounts of residue are generated which vary in type and danger level. The soil contamination by non aqueous liquid phase mixtures, specifically hydrocarbon petroleum has been a reason for great concern, mainly the aromatic and polycyclic aromatic, which present risk to human health due to its carcinogenic and mutagenic character. The Advanced Oxidative Processes (AOP) are efficient technologies for destruction of organic compounds of difficult degradation and, often, they are present in low concentrations. They can be considered clean technologies, because there is no formation of solid by-products or the transfer of pollutor phases. This work focuses on the study of the degradation of petroleum industrial waste, by Advanced Oxidation Processes. Treatments tackling petroleum residues, contaminated soil, and water occurring in the production of petroleum reached the following Polycyclic Aromatic Hydrocarbons (PAH) degradation levels: solid residues 100% in 96 treatment hours; water residue - 100% in 6 treatment hours; soil contamination (COT degradation) - 50.3% in 12 treatment hours. AOP were effective in dealing with petroleum residues thus revealing themselves to be a promising treatment alternative
Resumo:
During production of oil and gas, there is also the production of an aqueous effluent called produced water. This byproduct has in its composition salts, organic compounds, gases and heavy metals. This research aimed to evaluate the integration of processes Induced Air Flotation (IAF) and photo-Fenton for reducing the Total Oils and Greases (TOG) present in produced water. Experiments were performed with synthetic wastewater prepared from the dispersion of crude oil in saline solution. The system was stirred for 25 min at 33,000 rpm and then allowed to stand for 50 min to allow free oil separation. The initial oil concentration in synthetic wastewater was 300 ppm and 35 ppm for the flotation and the photo-Fenton steps, respectively. These values of initial oil concentration were established based on average values of primary processing units in Potiguar Basin. The processes were studied individually and then the integration was performed considering the best experimental conditions found in each individual step. The separation by flotation showed high removal rate of oil with first-order kinetic behavior. The flotation kinetics was dependent on both the concentration and the hydrophilic-lipophilic balance (HLB) of the surfactant. The best result was obtained for the concentration of 4.06.10-3 mM (k = 0.7719 min-1) of surfactant EO 2, which represents 86% of reduction in TOG after 4 min. For series of surfactants evaluated, the separation efficiency was found to be improved by the use of surfactants with low HLB. Regarding the TOG reduction step by photo-Fenton, the largest oil removal reached was 84% after 45 min of reaction, using 0.44 mM and 10 mM of ferrous ions and hydrogen peroxide, respectively. The best experimental conditions encountered in the integrated process was 10 min of flotation followed by 45 min of photo-Fenton with overall TOG reduction of 99%, which represents 5 ppm of TOG in the treated effluent. The integration of processes flotation and photo-Fenton proved to be highly effective in reducing TOG of produced water in oilfields
Resumo:
In northeastern semiarid, seasonality on precipitation temporal distribution, high intensity storm events and inadequate management of native vegetation can promote soil erosion. Vegetation removal causes soil surface exposure, reduces soil water storage capacity and can be the source degradation processes. In this context, this approach aims to analyze water and soil erosion processes on a 250 m2 undisturbed experimental plot with native vegetation, slope 2.5% by using 2006 and 2007 monitoring data. The site was instrumented to monitor rainfall, overland flow runoff and erosion by using a 5 m³ tank downstream the plot. Soil erosion monitoring was made by transported sediment and organic matter collection after each event. Field infiltration experiments were made at 16 points randomly distributed within the plot area by using a constant head infiltrometer during drought and rainy seasons, respectively. Infiltration data revealed high spatial and temporal variability. It was observed that during the beginning of the rainy period, 77% of the events showed runoff coefficient less than 0.05. As the rainy season began, soil water increase produced annual species germination. High intensity storms resulted in runoff coefficients varying between 0.33 and 0.42. Once the annual species was established, it was observed that approximately 39% of the events produced no runoff, which reflects an increase on soil water retention capacity caused by the vegetation. A gradual runoff reduction during the rainy season emphasizes the effect of vegetative density increase. Soil erosion observed data allowed to fit an empirical relationship involving soil loss and precipitation height, which was used to analyze the plot installation impact on soil erosion. Observed soil loss in 2006 and 2007 was 230 Kg/ha and 54 Kg/ha, respectively
Resumo:
Through out the course of a steady increase in search and recovery of space in the coastal zone, there is also an expanding concern about the erosion processes of this area. The main problem in coastal areas is that urbanization occurs in a disorderly fashion and unsustainable, further aggravating the problems of coastal dynamics. The study area of this work is located on the southern coast of Pirangi do Norte beach to about 20km south of Natal, capital of Rio Grande do Norte in the Parnamirim City. This area has the length of approximately 1km, divided into three sections (Western, Central and Eastern) with a morphology consisting of a tableland at the top, sea cliffs in the West and Central parts and sand dunes in the Eastern section, both vegetated, and a coastal plain on the inferior part associated with the presence of beach rocks. This study aimed to analyze the erosion processes operating in the excerpt of Pirangi do Norte beach and assess the feasibility of their monitoring making use of DGPS (Global Positioning System Differential mode). During the work it was carried out a physical description of the area through photo-interpretation and site survey after measurement of the shoreline in the period between November 2004 and November 2009 and beach profiles between August 2005 and July 2006. The analysis of the results of the annual surveys showed the occurrence of variations of the shoreline along the stretch traveled. Sites are identified in advancement coast from the sea and it was verified in loco the presence of erosion with deposition of materials on the lower part of the coastal bluff, the former position of the shoreline, showing a false notion of advancing it. This leads to the conclusion that the data collected in a survey of the shoreline should always be accompanied by photographic records of the local area and with the highest rate of erosion, thus avoiding the mistake of treating the deposit materials as evidence of progress coast. At the end of the study, after a review of various works to mitigate the erosion in the coastal zone, it is recommended to the area of study the adoption of an artificial feeding of the beach, aiming the minimization of the erosive effects of the tides. Moreover, it is suggested that even the continuity of monitoring, maintenance of existing vegetation and control of the occupation on the edge of sea cliffs
Resumo:
Eutrophication is a growing process present in the water sources located in the northeast of Brazil. Among the main consequences of these changes in trophic levels of a water source, stands out adding complexity to the treatment to achieve water standards. By these considerations, this study aimed to define, on a laboratory scale, products and operational conditions to be applied in the processing steps using raw water from Gargalheiras dam, RN, Brazil. The dam mentioned shows a high number of cyanobacteria, with a concentration of cells / ml higher than that established by Decree No. 518/04 MS. The same source was also considered by the state environmental agency in 2009 as hypereutrophic. The static tests developed in this research simulated direct filtration (laboratory filters) and pre-oxidation with chlorine and powdered activated carbon adsorption. The research included the evaluation of the coagulants aluminum hydrochloride (HCA) and alum (SA). The development of the research investigated the conditions for rapid mixing, the dosages of coagulants and pHs of coagulation by the drawing of diagrams. The interference of filtration rate and particle size of filtering means were evaluated as samples and the time of contact were tested with chlorine and activated carbon. By the results of the characterization of the raw water source it was possible to identify the presence of a high pH (7.34). The true color was significant (29 uH) in relation to the apparent color and turbidity (66 uH and 13.60 NTU), reflecting in the measurement of organic matter: MON (8.41 mg.L-1) and Abs254 (0.065 cm-1). The optimization of quick mix set time of 17", the speed gradient of 700 s-1 in the coagulation with HCA and the time of 20" with speed gradient of 800 s-1 for SA. The smaller particle sizes of sand filtering means helped the treatment and the variation in filtration rate did not affect significantly the efficiency of the process. The evaluation of the processing steps found adjustment in standard color and turbidity of the Decree nº 518/04 MS, taking in consideration the average values found in raw water. In the treatment using the HCA for direct filtration the palatable pattern based on the apparent color can be achieved with a dose of 25 mg L-1. With the addition of pre-oxidation step, the standard result was achieved with a reduced dose for 12 mgHCA.L-1. The turbidity standard for water was obtained by direct filtration when the dose exceeds 25 mg L-1 of HCA. With pre-oxidation step there is the possibility of reducing the dose to 20 mg L-1.The addition of CAP adsorption, promoted drinking water for both parameters, with even lower dosage, 13 mg L-1 of HCA. With coagulation using SA removal required for the parameter of apparent color it was achieved with pre-oxidation and 22 mgSA.L-1. Despite the satisfactory results of treatment with the alum, it was not possible to provide water with turbidity less than 1.00 NTU even with the use of all stages of treatment
Resumo:
There is still a lot to be said about the relationship between culture, cognition and language. Within an embodied cognition perspective to language, it may be understood that the senses generated and used in discourse are built and negotiated not only linguistically, since they also involve stereotypes, schemes, frames, etc. These cognitive structures, in turn, would emerge from subjects experiences and interactions with a sociohistorically constituted environment. With that in mind, what would happen if someone had an altered view in the perception of such environment? The objective of this master s thesis was to understand the process of meaning construction, aiming at the activation of frames, in the discourse of people who have been diagnosed as schizophrenic and have been hospitalized, that is, individuals who have their socio-environmental perception affected. With that aim in mind, a speech corpus was generated with three schizophrenic patients from Professor Severino Lopes Psychiatric Hospital. The data were collected and analyzed qualitatively, based on the theoretical and analytical premises of Cognitive Linguistics, more specifically, of Simulation Semantic perspective. Therefore, it was possible to identify aspects related to meaning construction processes in the discourse of schizophrenic patients, understanding that language is integrated with cognition and culture. Therefore, the alteration in the way experiences are perceived by schizophrenic patients affect the linguistic production of these subjects. Finally, if we take into consideration that the mental disturbance caused by schizophrenia results in a change in perception of reality by these individuals, we can infer an implication of such factors in language and, subsequently, the interference of such issues in the meaning construction processes in the discourse of patients diagnosed with schizophrenia
Resumo:
Esta es una pesquisa de naturaleza cualitativa de abordaje socio-histórico, con procedimientos etnográficos. Tiene como temática prácticas a constitución de subjetividades en relaciones interdiscursivas entre los discursos propalados por la Medicina Legal con prácticas discursivas de futuros(as) profesionales de la educación. En consecuencia de ese objeto de investigación, establecemos como cuestión central: ¿en qué medida prácticas discursivas producidas por la Medicina Legal producen sentidos en enunciados de alumnos y alumnas del curso de Pedagogía de UFRN, de modo a constituir subjetividades pautadas por el trastorno, por la anormalidad y por la enfermedad? En ese sentido, el objetivo de este trabajo es analizar prácticas discursivas institucionalizadas que constituyen subjetividades del género y sexualidad pautadas por efectos de sentidos que traducen las sexualidades disidentes como trastorno, perversión y anormalidad. Como herramientas teórico-analíticas actualizamos, principalmente, algunas reflexiones de Michel Foucault concernientes a la temática del biopoder y de la disciplina, algunas teorizaciones advenidas de los estudios Queer y nociones del Análisis del Discurso de línea francesa, como el discurso, memoria discursiva e interdiscurso. Los resultados de esta pesquisa demuestran que las subjetividades son constituidas en un proceso que alía el lenguaje de prácticas médicas, científicas, al habla de nuestros(as) colaboradores(as), en una relación interdiscursiva. Así, las subjetividades se constituyen pautadas por la anormalidad, por el trastorno, por la medicalización de las conductas y de los deseos. Todavía, percibimos el cruce de conductas biopolíticas y disciplinarizadoras en ese proceso de constitución de subjetividades, por medio de sanciones y posibles perjuicios que esos individuos anormales causan a la sociedad, justificadas tanto por los discursos de la Medicina Legal, como de los(as) colaboradores(as) de la pesquisa.