Humoral and cellular immune responses to Blomia tropicalis and concanavalin A-binding fractions in atopic patients

Blomia tropicalis, Dermatophagoides pteronyssinus and D. farinae are prevalent house dust mites. Concanavalin A-binding components derived from B. tropicalis (Bt-ConA extract) are highly immunogenic in allergic diseases. The aim of the present study was to evaluate the humoral and cellular immune responses to B. tropicalis in mite-sensitized patients. A total of 137 patients with allergic rhinitis with/without asthma and 109 non-atopic subjects were selected and analyzed by the skin prick test, and for total serum IgE and specific IgE levels to both Bt-total and Bt-ConA extracts, their proliferative response and cytokine (IFN-γ and IL-5) production by peripheral blood mononuclear cells (PBMC) stimulated with both extracts. Skin prick test showed that 70% of the patients were sensitized to Bt (Bt+) and similar levels of specific IgE to Bt-total and Bt-ConA extracts were demonstrable in Bt+ patients. Significant PBMC proliferation was observed in response to Bt-total extract in Bt+, but not in Bt- patients and non-atopic subjects (P < 0.001). Bt-ConA extract induced increased proliferative responses in all patient groups compared to medium alone (P < 0.05), but these responses were significantly decreased in the presence of the mannopyranoside ConA inhibitor (P < 0.05). Significant IFN-γ production was observed after Bt-ConA stimulation of Bt+ patients (P < 0.05), while Bt-total extract had no effect. IL-5 production was consistently detected in Bt+ patients after allergen-specific stimulation or with no stimulus, indicating that PBMC from allergic patients are prone to produce Th2 profile cytokines, spontaneously or inductively by allergen restimulation. These data showed that ConA-binding components isolated from B. tropicalis may contain relevant antigens that are involved in both humoral and cellular immune responses. However, without an additional purification procedure to eliminate the residual contamination with ConA, its use in immunotherapeutic procedures cannot be recommended.

New nitric oxide donors based on ruthenium complexes

Nitric oxide (NO) donors produce NO-related activity when applied to biological systems. Among its diverse functions, NO has been implicated in vascular smooth muscle relaxation. Despite the great importance of NO in biological systems, its pharmacological and physiological studies have been limited due to its high reactivity and short half-life. In this review we will focus on our recent investigations of nitrosyl ruthenium complexes as NO-delivery agents and their effects on vascular smooth muscle cell relaxation. The high affinity of ruthenium for NO is a marked feature of its chemistry. The main signaling pathway responsible for the vascular relaxation induced by NO involves the activation of soluble guanylyl-cyclase, with subsequent accumulation of cGMP and activation of cGMP-dependent protein kinase. This in turn can activate several proteins such as K+ channels as well as induce vasodilatation by a decrease in cytosolic Ca2+. Oxidative stress and associated oxidative damage are mediators of vascular damage in several cardiovascular diseases, including hypertension. The increased production of the superoxide anion (O2-) by the vascular wall has been observed in different animal models of hypertension. Vascular relaxation to the endogenous NO-related response or to NO released from NO deliverers is impaired in vessels from renal hypertensive (2K-1C) rats. A growing amount of evidence supports the possibility that increased NO inactivation by excess O2- may account for the decreased NO bioavailability and vascular dysfunction in hypertension.

Immune strategies using single-component LipL32 and multi-component recombinant LipL32-41-OmpL1 vaccines against leptospira

Genes encoding lipoproteins LipL32, LipL41 and the outer-membrane protein OmpL1 of leptospira were recombined and cloned into a pVAX1 plasmid. BALB/c mice were immunized with LipL32 and recombined LipL32-41-OmpL1 using DNA-DNA, DNA-protein and protein-protein strategies, respectively. Prime immunization was on day 1, boost immunizations were on day 11 and day 21. Sera were collected from each mouse on day 35 for antibody, cytokine detection and microscopic agglutination test while spleen cells were collected for splenocyte proliferation assay. All experimental groups (N = 10 mice per group) showed statistically significant increases in antigen-specific antibodies, in cytokines IL-4 and IL-10, as well as in the microscopic agglutination test and splenocyte proliferation compared with the pVAX1 control group. The groups receiving the recombined LipL32-41-OmpL1 vaccine induced anti-LipL41 and anti-OmpL1 antibodies and yielded better splenocyte proliferation values than the groups receiving LipL32. DNA prime and protein boost immune strategies stimulated more antibodies than a DNA-DNA immune strategy and yielded greater cytokine and splenocyte proliferation than a protein-protein immune strategy. It is clear from these results that recombination of protective antigen genes lipL32, lipL41, and ompL1 and a DNA-protein immune strategy resulted in better immune responses against leptospira than single-component, LipL32, or single DNA or protein immunization.

Immune cells and oxidative stress in the endotoxin tolerance mouse model

Sepsis is a systemic inflammatory response that can lead to tissue damage and death. In order to increase our understanding of sepsis, experimental models are needed that produce relevant immune and inflammatory responses during a septic event. We describe a lipopolysaccharide tolerance mouse model to characterize the cellular and molecular alterations of immune cells during sepsis. The model presents a typical lipopolysaccharide tolerance pattern in which tolerance is related to decreased production and secretion of cytokines after a subsequent exposure to a lethal dose of lipopolysaccharide. The initial lipopolysaccharide exposure also altered the expression patterns of cytokines and was followed by an 8- and a 1.5-fold increase in the T helper 1 and 2 cell subpopulations. Behavioral data indicate a decrease in spontaneous activity and an increase in body temperature following exposure to lipopolysaccharide. In contrast, tolerant animals maintained production of reactive oxygen species and nitric oxide when terminally challenged by cecal ligation and puncture (CLP). Survival study after CLP showed protection in tolerant compared to naive animals. Spleen mass increased in tolerant animals followed by increases of B lymphocytes and subpopulation Th1 cells. An increase in the number of stem cells was found in spleen and bone marrow. We also showed that administration of spleen or bone marrow cells from tolerant to naive animals transfers the acquired resistance status. In conclusion, lipopolysaccharide tolerance is a natural reprogramming of the immune system that increases the number of immune cells, particularly T helper 1 cells, and does not reduce oxidative stress.

Evaluation of the immune humoral response of Brazilian patients with Rubinstein-Taybi syndrome

Rubinstein-Taybi syndrome (RTS) is a rare developmental disorder characterized by craniofacial dysmorphisms, broad thumbs and toes, mental and growth deficiency, and recurrent respiratory infections. RTS has been associated with CREBBP gene mutations, but EP300 gene mutations have recently been reported in 6 individuals. In the present study, the humoral immune response in 16 RTS patients with recurrent respiratory infections of possible bacterial etiology was evaluated. No significant differences between patients and 16 healthy controls were detected to explain the high susceptibility to respiratory infections: normal or elevated serum immunoglobulin levels, normal salivary IgA levels, and a good antibody response to both polysaccharide and protein antigens were observed. However, most patients presented high serum IgM levels, a high number of total B cell and B subsets, and also high percentiles of apoptosis, suggesting that they could present B dysregulation. The CREBBP/p300 family gene is extremely important for B-cell regulation, and RTS may represent an interesting human model for studying the molecular mechanisms involved in B-cell development.

Evasion of immune responses by Trypanosoma cruzi, the etiological agent of Chagas disease

Infection with the protozoan parasite Trypanosoma cruzi leads to Chagas disease, which affects millions of people in Latin America. Infection with T. cruzi cannot be eliminated by the immune system. A better understanding of immune evasion mechanisms is required in order to develop more effective vaccines. During the acute phase, parasites replicate extensively and release immunomodulatory molecules that delay parasite-specific responses mediated by T cells. This immune evasion allows the parasite to spread in the host. In the chronic phase, parasite evasion relies on its replication strategy of hijacking the TGF-β signaling pathway involved in inflammation and tissue regeneration. In this article, the mechanisms of immune evasion described for T. cruzi are reviewed.

Amniotic fluid amino acid levels in non-immune hydrops fetalis: a case-control study

In a prospective case-control study, we compared the amniotic fluid amino acid levels in non-immune hydrops fetalis (NIHF) and normal fetuses. Eighty fetuses underwent amniocentesis for different reasons at the prenatal diagnosis unit of the Department of Obstetrics and Gynecology, Faculty of Medicine, Dicle University. Forty of these fetuses were diagnosed with NIHF. The study included 40 women each in the NIHF (mean age: 27.69 ± 4.56 years) and control (27.52 ± 5.49 years) groups, who had abnormal double- or triple-screening test values with normal fetuses with gestational ages of 23.26 ± 1.98 and 23.68 ± 1.49 weeks at the time of sample collection, respectively. Amniotic fluid amino acid concentrations (intra-assay variation: 2.26-7.85%; interassay variation: 3.45-8.22%) were measured using EZ:faast kits (EZ:faast GC/FID free (physiological) amino acid kit; Phenomenex, USA) by gas chromatography. The standard for quantitation was a mixture of free amino acids from Phenomenex. The levels of 21 amino acids were measured. The mean phosphoserine and serine levels were significantly lower in the NIHF group, while the taurine, α-aminoadipic acid (aaa), glycine, cysteine, NH4, and arginine (Arg) levels were significantly higher compared to control. Significant risk variables for the NIHF group and odds coefficients were obtained using a binary logistic regression method. The respective odds ratios and 95% confidence intervals for the risk variables phosphoserine, taurine, aaa, Arg, and NH4 were 3.31 (1.84-5.97), 2.45 (1.56-3.86), 1.78 (1.18-2.68), 2.18 (1.56-3.04), and 2.41 (1.66-3.49), respectively. The significant difference between NIHF and control fetuses suggests that the amniotic fluid levels of some amino acids may be useful for the diagnosis of NIHF.

Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Animal models of prenatal immune challenge and their contribution to the study of schizophrenia: a systematic review

Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Cocaine/levamisole-induced systemic vasculitis with retiform purpura and pauci-immune glomerulonephritis

Levamisole has been increasingly used as an adulterant of cocaine in recent years, emerging as a public health challenge worldwide. Levamisole-associated toxicity manifests clinically as a systemic vasculitis, consisting of cutaneous, hematological, and renal lesions, among others. Purpura retiform, cutaneous necrosis, intravascular thrombosis, neutropenia, and less commonly crescentic nephritis have been described in association with anti-neutrophil cytoplasmic antibodies (ANCAs) and other autoantibodies. Here we report the case of a 49-year-old male who was a chronic cocaine user, and who presented spontaneous weight loss, arthralgia, and 3 weeks before admission purpuric skin lesions in the earlobes and in the anterior thighs. His laboratory tests on admission showed serum creatinine of 4.56 mg/dL, white blood count 3,800/μL, hemoglobin 7.3 g/dL, urinalysis with 51 white blood cells/μL and 960 red blood cells/μL, and urine protein-to-creatinine ratio 1.20. Serum ANCA testing was positive (>1:320), as well as serum anti-myeloperoxidase and anti-proteinase 3 antibodies. Urine toxicology screen was positive for cocaine and levamisole, with 62.8% of cocaine, 32.2% of levamisole, and 5% of an unidentified substance. Skin and renal biopsies were diagnostic for leukocytoclastic vasculitis and pauci-immune crescentic glomerulonephritis, respectively. The patient showed a good clinical response to cocaine abstinence, and use of corticosteroids and intravenous cyclophosphamide. Last serum creatinine was 1.97 mg/dL, white blood cell count 7,420/μL, and hemoglobin level 10.8 g/dL. In levamisole-induced systemic vasculitis, the early institution of cocaine abstinence, concomitant with the use of immunosuppressive drugs in severe cases, may prevent permanent end organ damage and associate with better clinical outcomes.

Players of Th-cell differentiation and immune dysregulation – focus on GIMAP family genes

The balance of T helper (Th) cell differentiation is the fundamental process that ensures that the immune system functions correctly and effectively. The differentiation is a fine tuned event, the outcome of which is driven by activation of the T-cell in response to recognition of the specific antigen presented. The co-stimulatory signals from the surrounding cytokine milieu help to determine the outcome. An impairment in the differentiation processes may lead to an imbalance in immune responses and lead to immune-mediated pathologies. An over-representation of Th1 type cytokine producing cells leads to tissue-specific inflammation and autoimmunity, and excessive Th2 response is causative for atopy, asthma and allergy. The major factors of Th-cell differentiation and in the related disease mechanisms have been extensively studied, but the fine tuning of these processes by the other factors cannot be discarded. In the work presented in this thesis, the association of T-cell receptor costimulatory molecules CTLA4 and ICOS with autoimmune diabetes were studied. The underlying aspect of the study was to explore the polymorphism in these genes with the different disease rates observed in two geographically close populations. The main focus of this thesis was set on a GTPase of the immunity associated protein (GIMAP) family of small GTPases. GIMAP genes and proteins are differentially regulated during human Th-cell differentiation and have been linked to immune-mediated disorders. GIMAP4 is believed to contribute to the immunological balance via its role in T-cell survival. To elucidate the function of GIMAP4 and GIMAP5 and their role in human immunity, a study combining genetic association in different immunological diseases and complementing functional analyses was conducted. The study revealed interesting connections with the high susceptibility risk genes. In addition, the role of GIMAP4 during Th1-cell differentiation was investigated. A novel function of GIMAP4 in relation to cytokine secretion was discovered. Further assessment of GIMAP4 and GIMAP5 effect for the transcriptomic profile of differentiating Th1-cells revealed new insights for GIMAP4 and GIMAP5 function.

CLEVER-1 as an immune suppressive molecule

The immune response and immune suppression are equally essential for the immune system to protect the host against an infection and to protect self-molecules in different pathophysiological conditions. Pregnancy is one of the conditions where the maternal immune system remains resistant against microbes and yet attains tolerance to protect the fetus, whose genetic material differs partially from the mother’s. However, if the balance of immune suppression is not precise in the host it can favor conditions which lead to diseases, such as cancer and autoimmune disorders. This study was initiated to investigate the expression and functions of CLEVER-1/Stabilin-1, a multifunctional protein expressed on subsets of endothelial cells and type II macrophages, as an immune suppressive molecule. Firstly, the expression of CLEVER-1/stabilin-1 and its function in human placental macrophages were examined. Secondly, the expression profile and functional significance of stabilin-1 on healthy human monocytes was investigated. The results clarified the expression of CLEVER-1/stabilin-1 on placental macrophages, and verified that CLEVER-1/stabilin-1 functions as an adhesion and scavenging molecule on these cells. The data from normal monocytes revealed that the monocytes with low stabilin-1 expression carried a pro-inflammatory gene signature, and that stabilin-1 can directly or indirectly regulate pro-inflammatory genes in monocytes. Finally, it was shown that monocyte CLEVER-1/stabilin-1 dampens IFN production by T cells. To conclude, CLEVER-1/stabilin-1 is defined as an immune suppressive molecule on monocytes and macrophages. Strikingly, anti-stabilin-1 antibodies may have the potential to promote the Th1 dependent inflammatory response and counteract the tumor induced immune suppression.