999 resultados para Identificação Automática de Veículos
Resumo:
There has been an increasing tendency on the use of selective image compression, since several applications make use of digital images and the loss of information in certain regions is not allowed in some cases. However, there are applications in which these images are captured and stored automatically making it impossible to the user to select the regions of interest to be compressed in a lossless manner. A possible solution for this matter would be the automatic selection of these regions, a very difficult problem to solve in general cases. Nevertheless, it is possible to use intelligent techniques to detect these regions in specific cases. This work proposes a selective color image compression method in which regions of interest, previously chosen, are compressed in a lossless manner. This method uses the wavelet transform to decorrelate the pixels of the image, competitive neural network to make a vectorial quantization, mathematical morphology, and Huffman adaptive coding. There are two options for automatic detection in addition to the manual one: a method of texture segmentation, in which the highest frequency texture is selected to be the region of interest, and a new face detection method where the region of the face will be lossless compressed. The results show that both can be successfully used with the compression method, giving the map of the region of interest as an input
Resumo:
The fast urban occupation of Brazil, mainly from the last decade of 50, a sensible degradation of the quality of the air generated mainly for the activities was verified human beings associates to industrialization. From the past years, the situation has gotten worst in function of the increment of the fleet of vehicles in circulation in the great cities. Being these, in the city of Natal-RN, the ones that offer the biggest contributions to the atmospheric pollution. For atmospheric air to be a finite natural resources, indispensable and essential to the maintenance of the life in the land, is necessary to the implementation of action to improve its quality and to protect the health of the population. With the objective to study relative aspects to the characteristics of vehicles in use, the present study it searchs to analyze the levels of emissions of gases generated for vehicles converted bi-fuels into the modalities: natural gas (GNV), gasoline and alcohol, inspected for ends of register and together licensing to the State Department of Transit. One used the data gotten from inspections carried through for the company System Specialized in Inspection To propagate, in the city of the Natal-RN, capital of the State of Rio Grande do Norte, between 14 of November of 2003 and 30 of December of 2004. The analyzed parameters are established in the resolution nº 07/93 CONAMA. Of a total of 1.517 inspected vehicles, a average of 15,2% of failed was gotten, or either, that they emit levels of pollution above of the limits established for the legislation, below of the national average that is of 20,0%. The analysis of the data discloses that 7.3% of the fleet are converted the GNV; the growth of vehicles converted the GNV into the city is gradual, with a average of increment in last the 4 years of 23,3%; it has a vehicle predominance that has as combustible original to the gasoline (88,2%); the inspected fleet has average age of 8 years of use, considered young for the Brazilian standards, except for the moved one to the alcohol (average of use of 15 years). Moreover, the type of fuel is not the main parameter to define the indices of emissions; the age of the fleet is the parameter most important when emission is analyzed to propagate; the gas that more generates failed in the inspections is the corrected carbon monoxide; the vehicles generate higher indices of emissions in idling for all the fuels; the presence of the catalyser was not reflected, as it expected, in the reduction of emissions of gases toxic, however when analyzed according to year of manufacture, it was observed that for the vehicles manufactured between 1997 and 2004, reduction of 46,0% in the failed of the vehicles equipped with catalyser was gotten. In conclusion, the fleet of the studied sample, in average terms, takes care of to the requirements of Resolution CONAMA nº 07/93. The results gotten for the present study can subsidize action of public administrations that aim at to the improvement and the maintenance of the quality of air in the city of Natal-RN, as, for example, to implant a net of monitoramento of the quality of air
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Lotes de sementes de braquiária comercializados no Brasil vem apresentando contaminações com sementes de outras espécies pertencentes ao mesmo gênero. Deste modo, uma das espécies de braquiária atuaria como planta infestante da outra no agroecossistema e a erradicação da espécie infestante seria dificultada pela agressividade característica do gênero e pela falta de seletividade dos herbicidas disponíveis no mercado. Esses fatores ressaltam a importância da comercialização e utilização de lotes de sementes isento de sementes de outras espécies e a utilização de metodologias precisas de identificação das principais espécies de braquiária no controle de qualidade das empresas produtoras de sementes. Neste trabalho, buscou-se avaliar o potencial discriminante da técnica de eletroforese, utilizando quatro sistemas enzimáticos presentes em plântulas de quatro espécies do gênero Brachiaria, quer sejam B. brizantha cv. Marandu, B. decumbens cv. Basilisk, B. humidicola cv. comercial e B. plantaginea. Foram realizadas análises de eletroforese de isoenzimas testando-se 50 indivíduos de cada espécie por tratamento, utilizando-se coleóptilos de plântulas obtidas a partir de sementes germinadas a 30°C, no escuro. Para a eletroforese foi utilizado como meio suporte géis de poliacrilamida, nas concentrações de 7,0 e 7,5%. As isoenzimas Glutamato desidrogenase e Glucose-6-fosfato desidrogenase, embora eficientes na diferenciação entre B. plantaginea e B. humidicola e entre as sementes dessas espécies e as de B. brizantha ou B. decumbens, não se mostraram capazes de diferenciar as sementes destas duas últimas espécies. Entretanto, as izoenzimas α- e β-esterase possibilitaram uma nítida diferenciação das quatro espécies de Brachiaria estudadas.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Extended storage of refrigerated milk can lead to reduced quality of raw and processed milk, which is a consequence of the growth and metabolic activities of psychrotrophic bacteria, able to grow under 7oC or lower temperatures. Although most of these microorganisms are destroyed by heat treatment, some have the potential to produce termoresistant proteolytic and lipolytic enzymes that can survive even UHT processing and reduce the processed products quality. Recently, the IN 51 determineds that milk should be refrigerated and stored at the farm what increased the importance of this group of microorganisms. In this work, psychrotrophic bacteria were isolated from 20 communitarian bulk tanks and 23 individual bulk tanks from dairy farms located at Zona da Mata region of Minas Gerais State and from southeastern Rio de Janeiro. Selected milk dilutions were plated on standard agar and after incubation for 10 days at 7oC, five colonies were isolated, firstly using nutrient agar and after using McConkey agar for 24 hours at 21oC. The isolates were identified by morphology, Gram stain method, catalase production, fermentative/oxidative metabolism and by API 20E, API 20NE, API Staph, API Coryne or API 50 CH (BioMerieux). In order to ensure reproductibility, API was repeated for 50% of the isolates. Species identification was considered when APILAB indexes reached 75% or higher. 309 strains were isolated, 250 Gram negative and 59 Gram positive. 250 Gram negative isolates were identified as: Acinetobacter spp. (39), Aeromonas spp. (07), A. Hydrophila (16), A. sobria (1), A. caviae (1), Alcaligenes feacalis (1), Burkholderia cepacia (12), Chryseomonas luteola (3), Enterobacter sp. (1), Ewingella americana(6), Hafnia alvei (7), Klebsiella sp. (1), Klebsiella oxytoca (10), Yersinia spp. (2), Methylobacterium mesophilicum (1), Moraxella spp. (4), Pantoea spp. (16), Pasteurella sp. (1), Pseudomonas spp. (10), P. fluorescens (94), P. putida (3), Serratia spp. (3), Sphigomonas paucomobilis (1). Five isolates kept unidentified. Pseudomonas was the predominant bacteria found (43%) and P. fluorescens the predominant species (37.6%), in accordance with previous reports. Qualitative analysis of proteolytic and lipolytic activity was based on halo formation using caseinate agar and tributirina agar during 72 hours at 21oC and during 10 days at 4°C, 10oC and 7°C. Among 250 Gram negative bacteria found, 104 were identified as Pseudomonas spp. and 60,57% of this group showed proteolytic and lipolytic acitivities over all four studied temperatures. 20% of Acinetobacter, Aeromonas, Alcaligenes, Burkholderia, Chryseomonas, Methylobacterium, Moraxella presented only lipolytic activity. Some isolates presented enzymatic activity in one or more studied temperatures. Among Gram positive bacteria, 30.51% were proteolytic and lipolytic at 10oC, 8.47% were proteolytic at 7oC, 10oC, and 21oC, 8.47% were proteolytic at all studied temperatures (4oC, 7oC, 10oC and 21oC) and 3.38% were proteolytic only at 21oC. At 4oC, only one isolate showed proteolytic activity and six isolates were lipolytic. In relation to Gram negative microorganisms, 4% were proteolytic and lipolytic at 7oC, 10oC and 21oC, 10% were proteolytic at 10oC and 4.4% were lipolytic at 4oC, 7oC, 10oC and 21oC, while 6.4% of all isolates were proteolytic and lipolytic at 10oC and 21oC as well as lipolytic at 4oC and 7oC. These findings are in accordance with previous researches that pointed out Pseudomonas as the predominant psycrotrophic flora in stored refrigerated raw milk
Resumo:
Devido a grande importância da cultura de Eucalyptus no Brasil, empresas do setor florestal têm buscado através de programas de melhoramento genético, reduzir as perdas de produção e atender a demanda do mercado de papel e celulose. Um exemplo, é a busca por genes de resistência a doenças, principalmente a ferrugem causada por Puccinia psidii Winter, que resulta em redução da produtividade em plantas altamente suscetíveis. No presente trabalho, mudas de Eucalyptus pertencentes a uma geração F1, provenientes do cruzamento controlado entre parentais híbridos E. grandis X E. urophylla, sendo eles resistente e suscetível, foram inoculadas com Puccinia psidii em casa de vegetação e acompanhadas até o aparecimento dos sintomas da ferrugem. Foram classificadas, em dois grupos: resistentes (ausência de sintomas) e suscetíveis (presença de sintomas e esporulação). As amostras de DNA foram comparadas com o uso de marcadores moleculares associado ao método de BSA (Bulked Segregant Analysis). O polimorfismo entre os grupos foi geneticamente relacionado ao loco que determina a característica de resistência ou sucetibilidade. Dentre os 720 primers testados, 19 foram polimórficos, porém, apenas o marcador AK 01 manteve-se presente, quando testado em todos os indivíduos da população, mostrando-se a uma distância genética estimada de 20 cM em repulsão ao gene de resistência.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The semiarid rainfall regime is northeastern Brazil is highly variable. Climate processes associated with rainfall are complex and their effects may represent extreme situations of drought or floods, which can have adverse effects on society and the environment. The regional economy has a significant agricultural component, which is strongly influenced by weather conditions. Maximum precipitation analysis is traditionally performed using the intensity-duration-frequency (IDF) probabilistic approach. Results from such analysis are typically used in engineering projects involving hydraulic structures such as drainage network systems and road structures. On the other hand, precipitation data analysis may require the adoption of some kind of event identification criteria. The minimum inter-event duration (IMEE) is one of the most used criteria. This study aims to analyze the effect of the IMEE on the obtained rain event properties. For this purpose, a nine-year precipitation time series (2002- 2011) was used. This data was obtained from an automatic raingauge station, installed in an environmentally protected area, Ecological Seridó Station. The results showed that adopted IMEE values has an important effect on the number of events, duration, event height, mean rainfall rate and mean inter-event duration. Furthermore, a higher occurrence of extreme events was observed for small IMEE values. Most events showed average rainfall intensity higher than 2 mm.h-1 regardless of IMEE. The storm coefficient of advance was, in most cases, within the first quartile of the event, regardless of the IMEE value. Time series analysis using partial time series made it possible to adjust the IDF equations to local characteristics
Resumo:
O estudo da variabilidade da precipitação é importante para o planejamento das atividades econômicas, possibilitando o uso mais eficiente e racional dos recursos hídricos. Dessa forma, o objetivo desta pesquisa é caracterizar o estado do Rio Grande do Norte com relação à variabilidade temporal da precipitação, agrupá-lo em regiões homogêneas e comparar diferentes técnicas de agrupamento. Para o estudo da variabilidade pluvial foram utilizados os índices: Grau de Concentração de Precipitação (PCD), que representa o grau em que a precipitação é distribuída ao longo do ano; e o Período de Concentração de Precipitação (PCP), que reflete o período no qual a precipitação está mais concentrada. Para a realização dos agrupamentos foram escolhidas as variáveis: PCD, PCP, médias da precipitações anuais e médias das precipitações mensais. Posteriormente, foi aplicada a análise de agrupamento para obter grupos com características similares. Os resultados mostraram que as precipitações são melhor distribuídas na região leste do estado, neste caso, os meses mais chuvosos são de maio a agosto. Os municípios localizados nessa área possuem dois picos de chuvas, devido à atuação de dois sistemas: Perturbações Ondulatórias dos Alísios (POA s) e Zona de Convergência Intertropical (ZCIT). Nas regiões localizadas a oeste os meses que possuem maior concentração de chuvas são março e abril, neste caso temos apenas um pico de precipitação, devido a atuação da ZCIT. A identificação de áreas homogêneas favorece o planejamento adequado de acordo com as características de cada grupo formado e o RN pode foi dividido em 4 (quatro) regiões homogêneas. As técnicas de agrupamento utilizadas apresentaram resultados semelhantes, porém, sugere-se o uso de mais de uma técnica para que se possa analisar qual delas reflete melhor a realidade local. O estudo da variabilidade de precipitação, através dos índices estudados e do agrupamento realizado, são ferramentas adequadas ao planejamento ambiental e econômico
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
This paper proposes a methodology for automatic extraction of building roof contours from a Digital Elevation Model (DEM), which is generated through the regularization of an available laser point cloud. The methodology is based on two steps. First, in order to detect high objects (buildings, trees etc.), the DEM is segmented through a recursive splitting technique and a Bayesian merging technique. The recursive splitting technique uses the quadtree structure for subdividing the DEM into homogeneous regions. In order to minimize the fragmentation, which is commonly observed in the results of the recursive splitting segmentation, a region merging technique based on the Bayesian framework is applied to the previously segmented data. The high object polygons are extracted by using vectorization and polygonization techniques. Second, the building roof contours are identified among all high objects extracted previously. Taking into account some roof properties and some feature measurements (e. g., area, rectangularity, and angles between principal axes of the roofs), an energy function was developed based on the Markov Random Field (MRF) model. The solution of this function is a polygon set corresponding to building roof contours and is found by using a minimization technique, like the Simulated Annealing (SA) algorithm. Experiments carried out with laser scanning DEM's showed that the methodology works properly, as it delivered roof contours with approximately 90% shape accuracy and no false positive was verified.
Resumo:
This paper proposes a monoscopic method for automatic determination of building's heights in digital photographs areas, based on radial displacement of points in the plan image and geometry at the time the photo is obtained. Determination of the buildings' heights can be used to model the surface in urban areas, urban planning and management, among others. The proposed methodology employs a set of steps to detect arranged radially from the system of photogrammetric coordinates, which characterizes the lateral edges of buildings present in the photo. In a first stage is performed the reduction of the searching area through detection of shadows projected by buildings, generating sub-images of the areas around each of the detected shadow. Then, for each sub-image, the edges are automatically extracted, and tests of consistency are applied for it in order to be characterized as segments of straight arranged radially. Next, with the lateral edges selected and the knowledge of the flight height, the buildings' heights can be calculated. The experimental results obtained with real images showed that the proposed approach is suitable to perform the automatic identification of the buildings height in digital images.
Resumo:
This article proposes a method for 3D road extraction from a stereopair of aerial images. The dynamic programming (DP) algorithm is used to carry out the optimization process in the object-space, instead of usually doing it in the image-space such as the DP traditional methodologies. This means that road centerlines are directly traced in the object-space, implying that a mathematical relationship is necessary to connect road points in object and image-space. This allows the integration of radiometric information from images into the associate mathematical road model. As the approach depends on an initial approximation of each road, it is necessary a few seed points to coarsely describe the road. Usually, the proposed method allows good results to be obtained, but large anomalies along the road can disturb its performance. Therefore, the method can be used for practical application, although it is expected some kind of local manual edition of the extracted road centerline.