972 resultados para H63d Mutation


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Wilson`s disease (WD) is a rare inborn metabolic error characterized by deficient biliary copper excretion secondary to ATP7B gene mutations. Neurological presentations are variable in respect to both pattern and age of onset; commonly a movement disorder presents in the second or third decade. The aim of this study was to ascertain genotype correlations with distinct neurological manifestations in 41 WD patients in a Brazilian center for WD. A total of 23 distinct mutations were detected, and the frameshift 3402de1C had the highest allelic frequency (31.7%). An association between 3402de1C and dysphagia was detected (p = 0.01) but the limited number of patients is insufficient to allow one to draw conclusions. Both clinical studies analyzing larger cohorts and basic research on ATP7B protein function could potentially shed more light on our understanding of WD. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: The potential involvement of SRY in abnormal gonadal development in 45,X/46,X,der(Y) patients was proposed following the identification of SRY mutations in a few patients with Turner syndrome (TS). However, its exact etiological role in gonadal dysgenesis in patients with Y chromosome mosaicisms has not yet been clarified. Aims: It was the aim of this study to screen for allelic variation in SRY in a large cohort of patients with disorders of sex development due to chromosomal abnormalities with 45, X/46, X, der(Y) karyotype. Patients: Twenty-seven patients, 14 with TS and 13 with mixed gonadal dysgenesis (MGD), harboring 45, X/46, X, der(Y) karyotypes were selected. Methods: Genomic DNA was extracted from peripheral blood leukocytes of all patients and from gonadal tissue in 4 cases. The SRY coding region was PCR amplified and sequenced. Results: We identified only 1 polymorphism (c.561C -> T) in a 45,X/46,XY MGD patient, which was detected in blood and in gonadal tissue. Conclusion: Our results indicate that mutations in SRY are rare findings in patients with Y chromosome mosaicisms. Therefore, a significant role of mutated SRY in the etiology of gonadal dysgenesis in patients harboring 45, X/46, XY karyotype and variants seems very unlikely. Copyright (C) 2010 S. Karger AG, Basel

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multiple endocrine neoplasia type 2 is characterized by germline mutations in RET. For exon 10, comprehensive molecular and corresponding phenotypic data are scarce. The International RET Exon 10 Consortium, comprising 27 centers from 15 countries, analyzed patients with RET exon 10 mutations for clinical-risk profiles. Presentation, age-dependent penetrance, and stage at presentation of medullary thyroid carcinoma (MTC), pheochromocytoma, and hyperparathyroidism were studied. A total of 340 subjects from 103 families, age 4-86, were registered. There were 21 distinct single nucleotide germline mutations located in codons 609 (45 subjects), 611 (50), 618 (94), and 620 (151). MTC was present in 263 registrants, pheochromocytoma in 54, and hyperparathyroidism in 8 subjects. Of the patients with MTC, 53% were detected when asymptomatic, and among those with pheochromocytoma, 54%. Penetrance for MTC was 4% by age 10, 25% by 25, and 80% by 50. Codon-associated penetrance by age 50 ranged from 60% (codon 611) to 86% (620). More advanced stage and increasing risk of metastases correlated with mutation in codon position (609-620) near the juxtamembrane domain. Our data provide rigorous bases for timing of premorbid diagnosis and personalized treatment/prophylactic procedure decisions depending on specific RET exon 10 codons affected. Hum Mutat 32:51-58, 2011. (C) 2010 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

LRRK2 mutations can cause familial and sporadic Parkinson`s disease (PD) with Lewy-body pathology at post-mortem. Studies of olfaction in LRRK2 are sparse and incongruent. We applied a previously validated translation of the 16 item smell identification test from Sniffin` Sticks (SS-16) to 14 parkinsonian carriers of heterozygous G2019S LRRK2 mutation and compared with 106 PD patients and 118 healthy controls. The mean SS-16 score in LRRK2 was higher than in PD (p < 0.001, 95% CI for beta = -4.7 to -1.7) and lower than in controls (p = 0.007, 95% CI for beta = +0.6 to +3.6). In the LRRK2 group, subjects with low scores had significantly more dyskinesia. They also had younger age of onset, longer disease duration, and reported less frequently a family history of PD, but none of these other differences reached significance. Odor identification is diminished in LRRK2 parkinsonism but not to the same extent as in idiopathic PD. (C) 2010 Movement Disorder Society

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Context: GLI2 is a transcription factor downstream in Sonic Hedgehog signaling, acting early in ventral forebrain and pituitary development. GLI2 mutations were reported in patients with holoprosencephaly (HPE) and pituitary abnormalities. Objective: The aim was to report three novel frameshift/nonsense GLI2 mutations and the phenotypic variability in the three families. Setting: The study was conducted at a university hospital. Patients and Methods: The GLI2 coding region of patients with isolated GH deficiency (IGHD) or combined pituitary hormone deficiency was amplified by PCR using intronic primers and sequenced. Results: Three novel heterozygous GLI2 mutations were identified: c. 2362_2368del p. L788fsX794 (family 1), c. 2081_2084del p. L694fsX722 (family 2), and c. 1138 G > T p. E380X (family 3). All predict a truncated protein with loss of the C-terminal activator domain. The index case of family 1 had polydactyly, hypoglycemia, and seizures, and GH, TSH, prolactin, ACTH, LH, and FSH deficiencies. Her mother and seven relatives harboring the same mutation had polydactyly, including two uncles with IGHD and one cousin with GH, TSH, LH, and FSH deficiencies. In family 2, a boy had cryptorchidism, cleft lip and palate, and GH deficiency. In family 3, a girl had hypoglycemia, seizures, excessive thirst and polyuria, and GH, ACTH, TSH, and antidiuretic hormone deficiencies. Magnetic resonance imaging of four patients with GLI2 mutations and hypopituitarism showed a hypoplastic anterior pituitary and an ectopic posterior pituitary lobe without HPE. Conclusion: We describe three novel heterozygous frameshift or nonsense GLI2 mutations, predicting truncated proteins lacking the activator domain, associated with IGHD or combined pituitary hormone deficiency and ectopic posterior pituitary lobe without HPE. These phenotypes support partial penetrance, variable polydactyly, midline facial defects, and pituitary hormone deficiencies, including diabetes insipidus, conferred by heterozygous frameshift or nonsense GLI2 mutations. (J Clin Endocrinol Metab 95: E384-E391, 2010)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study analyzed the genotype distribution and frequency of lamivudine (LAM) and tenofovir (TDF) resistance mutations in a group of patients co-infected with HIV and hepatitis B virus (HBV). A cross-sectional study of 847 patients with HIV was conducted. Patients provided blood samples for HBsAg detection. The load of HBV was determined using an ""in-house"" real-time polymerase chain reaction. HBV genotypes/subgenotypes, antiviral resistance, basal core promoter (BCP), and precore mutations were detected by DNA sequencing. Twenty-eight patients with co-infection were identified. The distribution of HBV genotypes among these patients was A (n = 9; 50%), D (n = 4; 22.2%), G (n = 3; 16.7%), and F (n = 2; 11.1%). Eighteen patients were treated with LAM and six patients were treated with LAM plus TDF. The length of exposure to LAM and TDF varied from 4 to 216 months. LAM resistance substitutions (rtL180M + rtM204V) were detected in 10 (50%) of the 20 patients with viremia. This pattern and an accompanying rtV173L mutation was found in four patients. Three patients with the triple polymerase substitution pattern (rtV173L+ rtL180M + rtM204V) had associated changes in the envelope gene (sE164D + sl195M). Mutations in the BCP region (A1762T, G1764A) and in the precore region (G1896A, G1899A) were also found. No putative TDF resistance substitution was detected. The data suggest that prolonged LAM use is associated with the emergence of particular changes in the HBV genome, including substitutions that may elicit a vaccine escape phenotype. No putative TDF resistance change was detected after prolonged use of TDF. J. Med. Virol. 82:1481-1488, 2010. (C) 2010 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

P>Context Congenital generalized lipodystrophy, or Berardinelli-Seip syndrome, is a rare autosomal recessive disease caused by mutations in either the BSCL2 or AGPAT2 genes. This syndrome is characterized by an almost complete loss of adipose tissue usually diagnosed at birth or early infancy resulting in apparent muscle hypertrophy. Common clinical features are acanthosis nigricans, hepatomegaly with or without splenomegaly and high stature. Acromegaloid features, cardiomyopathy and mental retardation can also be present. Design We investigated 11 kindreds from different geographical areas of Brazil (northeast and southeast). All coding regions as well as flanking intronic regions of both genes were examined. Polymerase chain reaction (PCR) amplifications were performed using primers described previously and PCR products were sequenced directly. Results Four AGPAT2 and two BSCL2 families harboured the same set of mutations. BSCL2 gene mutations were found in the homozygous form in four kindreds (c.412C > T c.464T > C, c.518-519insA, IVS5-2A > G), and in two kindreds compound mutations were found (c.1363C > T, c.424A > G). In the other four families, one mutation of the AGPAT2 gene was found (IVS3-1G > C and c.299G > A). Conclusions We have demonstrated four novel mutations of the BSCL2 and AGPAT2 genes responsible for Berardinelli-Seip syndrome and Brunzell syndrome (AGPAT2-related syndrome).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose of review To perform an update review on thyroglobulin gene mutations associated with congenital hypothyroidism, thyroid cancer, and autoimmunity. Recent findings Forty-two thyroglobulin mutations have been identified in dyshormonogenetic congenital hypothyroidism. Clinical and laboratory criteria defining defective thyroglobulin synthesis are mostly related to thyroglobulin mutations, generally caused by intracellular thyroglobulin transport defects to the colloid rather than defects in thyroid hormones synthesis. Some mutated thyroglobulin may escape the rigorous chaperone control and reach the colloid, allowing a wide phenotypic spectrum that includes euthyroidism in an adequate iodine environment. In some patients, continuous levothyroxine treatment does not reduce elevated serum thyroid-stimulating hormone (TSH) levels that may lead to goiter development. Prenatally, inactive mutant thyroglobulin will not be able to synthesize thyroid hormones and may increase pituitary thyrotroph threshold for thyroid hormone feedback. Congenital goiter is a risk factor for thyroid cancer and some thyroglobulin variants may confer susceptibility to thyroid autoimmunity. Summary Advances in the understanding of thyroglobulin genetic defects and its severity should allow researchers to perform adequate molecular diagnosis, genetic counseling, and intrauterine treatment to prevent subtle deficits in central nervous system development. This knowledge should improve the understanding of physiological functions of the thyroid and influence of nutritional iodine.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The rms4 mutant of pea (Pisum sativum L.) was used in grafting studies and cytokinin analyses of the root xylem sap to provide evidence that, at least for pea, the shoot can modify the import of cytokinins from the root. The rms4 mutation, which confers a phenotype with increased branching in the shoot, causes a very substantial decrease (down to 40-fold less) in the concentration of zeatin riboside (ZR) in the xylem sap of the roots. Results from grafts between wild-type (WT) and rms4 plants indicate that the concentration of cytokinins in the xylem sap of the roots is determined almost entirely by the genotype of the shoot. WT scions normalize the cytokinin concentration in the sap of rms4 mutant roots, whereas mutant scions cause WT roots to behave like those of self-grafted mutant plants. The mechanism whereby rms4 shoots of pea cause a down-regulation in the export of cytokinins from the roots is unknown at this time. However, our data provide evidence that the shoot transmits a signal to the roots and thereby controls processes involved in the regulation of cytokinin biosynthesis in the root.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Context: Necdin activates GNRH gene expression and is fundamental for the development, migration, and axonal extension of murine GNRH neurons. In humans, necdin plays a potential role in the hypogonadotropic hypogonadism phenotype in patients with Prader-Willi syndrome. Aim: To investigate necdin gene (NDN) variants in patients with isolated hypogonadotropic hypogonadism (IHH). Patients and methods: We studied 160 Brazilian patients with IHH, which includes 92 with Kallmann syndrome and 68 with normosmic IHH. Genomic DNA was extracted and the single NDN exon was amplified and sequenced. To measure GNRH transcriptional activity, luciferase reporter plasmids containing GNRH regulatory regions were transiently transfected into GT1-7 cells in the presence and absence of overexpressed wild-type or mutant necdin. Results: A heterozygous variant of necdin, p.V318A, was identified in a 23-year-old male with Kallmann syndrome. The p.V318A was also present in affected aunt and his father and was absent in 100 Brazilian control subjects. Previous FGFR1 gene analysis revealed a missense mutation (p.P366L) in this family. Functional studies revealed a minor difference in the activation of GNRH transcription by mutant protein compared with wild type in that a significant impairment of the necdin protein activity threshold was observed. Conclusion: A rare variant of necdin (p.V318A) was described in a family with Kallmann syndrome associated with a FGFR1 mutation. Familial segregation and in vitro analysis suggested that this non-synonymous variant did not have a direct causative role in the hypogonadism phenotype. NDN mutations are not a frequent cause of congenital IHH.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Context Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. Objectives To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. Design, Setting, and Participants We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. Main Outcome Measures The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. Results We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P=2.7 x 10(-4)) and/or with familial disease (5 of 20 samples; P=.005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P=.54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Conclusions Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occured in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein. JAMA. 2010;304(23):2611-2619 www.jama.com

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Various members of the bZip and bHLH-Zip families of eukaryotic transcription factors, including Jun, Fos, and Myc, have been identified as oncoproteins; mutation or deregulated expression of these proteins leads to certain types of cancer. These proteins can only bind to their cognate DNA enhancer sites following homodimerization, or heterodimerization with another family member, via their leucine zipper domain. Thus, a novel anticancer strategy would be to inhibit dimerization of these proteins, thereby blocking their DNA binding and transactivation functions. In this paper we show that it is possible to rationally design leucine zipper peptides that bind with high affinity to the leucine zipper dimerization domains of c-Jun and c-Fos, thus preventing the formation of functional c-Jun homodimers and c-Jun:c-Fos heterodimers; we refer to such peptides as superzippers (SZs). In vivo, c-Jun:SZ and c-Fos:SZ heterodimers should be nonfunctional as they lack one of the two basic domains that are essential for DNA binding. While the transport of a peptidic agent into cells often poses a severe obstacle to its therapeutic use, we show that a 46-residue leucine zipper peptide can be transported into HeLa cells by coupling it to a 17-residue carrier peptide from the Antennapedia homeodomain, thus paving the way for detailed studies of the therapeutic potential of superzipper peptides.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Homocystinuria, due to a deficiency of the enzyme cystathionine beta-synthase (CBS), is an inborn error of sulphur-amino acid metabolism, This is an autosomal recessive disease which results in hyperhomocysteinaemia and a wide range of clinical features, including optic lens dislocation, mental retardation, skeletal abnormalities and premature thrombotic events, We report the identification of 5 missense mutations in the protein-coding region of the CBS gene from 3 patients with pyridoxine-nonresponsive homocystinuria. Reverse-transcription PCR was used to amplify CBS cDNA from each patient and the coding region was analysed by direct sequencing, The mutations detected included 3 novel (1058C --> T, 992C --> A and 1316G --> A) and 2 previously identified (430G --> A and 833C --> T) base alterations in the CBS cDNA, Each of these mutations predicts a single amino acid substitution in the CBS polypeptide, Appropriate cassettes of patient CBS cDNA, containing each of the above defined mutations, were used to replace the corresponding cassettes of normal CBS cDNA sequence within the bacterial expression vector pT7-7. These recombinant mutant and normal CBS constructs were expressed in Escherichia coli cells and the catalytic activities of the mutant proteins were compared with normal. All of the mutant proteins exhibited decreased catalytic activity in vitro, which confirmed the association between the individual mutation and CBS dysfunction in each patient.