987 resultados para Bandas de Congo
Resumo:
O objetivo deste trabalho foi avaliar o efeito de sistemas de rotação de culturas e de corretivos da acidez nas propriedades físicas do solo. O experimento foi realizado entre outubro de 2006 e julho de 2008, em Botucatu, SP, em blocos ao acaso, com parcelas subdivididas e oito repetições. As parcelas foram constituídas por quatro sistemas de rotação: soja/pousio/milho/pousio, soja/aveia-branca/milho/feijão, soja/milheto/milho/guandu e soja/braquiária/milho/braquiária. As subparcelas consistiram do tratamento testemunha, sem correção, e da aplicação de 3,8 Mg ha-1 de calcário dolomítico (PRNT = 90%) ou de 4,1 Mg ha-1 de silicato de cálcio e magnésio (PRNT = 80%), na superfície de um Latossolo Vermelho argiloso. Foram determinadas: estabilidade de agregados, densidade do solo, porosidade total, macro e microporosidade, resistência do solo à penetração e umidade do solo. A aplicação dos corretivos de acidez em superfície não reduz a agregação do solo e aumenta a macroporosidade até 0,20 m de profundidade, após aplicação de silicato, e até 0,10 m, após aplicação de calcário. A manutenção do solo em pousio, na entressafra, prejudica a estruturação do solo, reduz a estabilidade de agregados e aumenta a resistência à penetração nas camadas superficiais. A semeadura de braquiária, entre as safras de verão, aumenta a estabilidade de agregados até 0,10 m de profundidade.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The increasing demand for energy and the environment consequences derived from the use of fossil energy, beyond the future scarcity of the oil that currently is the main power plant of the world, it stimulated the research around the production of biodiesel. In this work the synthesis of biodiesel of cotton in the methyl route was carried through, for had been in such a way used catalyst commercial homogeneous, Na-Methylat and the K-Methylat, aiming to the evaluation of the efficiency of them. An experimental planning 23 was elaborated aiming to evaluate the influence of the variable (molar reason oil/alcohol, % of catalyst and temperature) in the process as well as indicating the excellent point of operation in each case. The biodiesel was analyzed by gaseous chromatography, indicating a conversion of 96,79% when used Na-Methylat® as catalytic, and 95,65% when the K-Methylat® was used. Optimum result found with regard to the conversion was obtained at the following conditions: molar reason oil/alcohol (1:8), temperature of 40°C and 1% of catalyst Na-Methylat, reaching a 96,79% conversion, being, therefore, above of the established for the European norm (96.5%). The analysis of regression showed that the only significant effect for a confidence level of 95%, was of the changeable temperature. The variance analysis evidenced that the considered model is fitted quite to the experimental response, being statistically significant; however it does not serve inside for make forecasts of the intervals established for each variable. The best samples were analyzed by infra-red (IR) that identified the strong bands of axial deformation C=O of methylic ester, characterized through analyses physicochemical that had indicated conformity with the norms of the ANP, that with the thermal and rheological analyses had together evidenced that biodiesel can be used as combustible alternative in substitution to diesel
Resumo:
Expanded Bed Adsorption plays an important role in the downstream processing mainly for reducing costs as well as steps besides could handling cells homogenates or fermentation broth. In this work Expanded Bed Adsorption was used to recover and purify whey proteins from coalho cheese manufacture using Streamline DEAE and Streamline SP both ionic resins as well as a hydrophobic resin Streamline Phenyl. A column of 2.6 cm inner diameter with 30 cm in height was coupled to a peristaltic pump. Hydrodynamics study was carried out with the three resins using Tris-HCl buffer in concentration of 30, 50 and 70 mM, with pH ranging from 7.0 to 8.0. In this case, assays of the expansion degree as well as Residence Time Distribution (RTD) were carried out. For the recovery and purification steps, a whey sample of 200 mL, was submitted to a column with 25mL of resin previously equilibrated with Tris/HCl (50 mM, pH 7.0) using a expanded bed. After washing, elution was carried out according the technique used. For ionic adsorption elution was carried out using 100 mL of Tris/HCl (50 mM, pH 7.0 in 1M NaCl). For Hydrophobyc interaction elution was carried out using Tris/HCl (50 mM, pH 7.0). Adsorption runs were carried out using the three resins as well as theirs combination. Results showed that for hydrodynamics studies a linear fit was observed for the three resins with a correlation coefficient (R2) about 0.9. In this case, Streamline Phenyl showed highest expansion degree reaching an expansion degree (H0/H) of 2.2. Bed porosity was of 0.7 when both resins Streamline DEAE and Streamline SP were used with StremLine Phenyl showing the highest bed porosity about 0.75. The number of theorical plates were 109, 41.5 and 17.8 and the axial dipersion coefficient (Daxial) were 0.5, 1.4 and 3.7 x 10-6 m2/s, for Streamline DEAE, Streamline SP and Streamline Phenyl, respectively. Whey proteins were adsorved fastly for the three resins with equilibrium reached in 10 minutes. Breakthrough curves showed that most of proteins stays in flowthrough as well as washing steps with 84, 77 and 96%, for Streamline DEAE, Streamline SP and Streamline Phenyl, respectively. It was observed protein peaks during elution for the three resins used. According to these peaks were identified 6 protein bands that could probably be albumin (69 KDa), lactoferrin (76 KDa), lactoperoxidase (89 KDa), β-lactoglobulin (18,3 KDa) e α-lactoalbumin (14 KDa), as well as the dimer of beta-lactoglobulin. The combined system compound for the elution of Streamline DEAE applied to the Streamline SP showed the best purification of whey proteins, mainly of the α-lactoalbumina
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Em Santa Bárbara D'Oeste,SP, foram realizados dois mapeamentos do uso da terra em área de 14.625 ha. No primeiro utilizou-se fotografias aéreas verticais pancromáticas (data de 25/6/78), na escala 1:35.000, e no segundo utilizou-se imagens orbitais do satélite LANDSAT-5 com sensor Thematic Mapper (data de 12/8/91), escala 1: 100.000, nas bandas 3, 4 e 5 e composição colorida 3/4/5. Para auxiliar a confecção desses mapas, obteve-se chaves de interpretação, tanto para as aerofotos como para as imagens orbitais. As fotografias aéreas proporcionaram um maior nível de detalhamento na identificação do uso da terra. A banda 3 e a composição colorida 3/4/5 foram as mais eficientes entre as imagens orbitais. Entre 1978 e 1991, a área de ocorrência de cana-de-açúcar permaneceu a mesma, as áreas de mata e pastagem diminuíram, enquanto que as áreas de reflorestamento e urbana aumentaram. Essa região teve sua capacidade de uso enquadrada, na maior parte, na classe IV: terras mais apropriadas para pastagens ou plantas perenes como a cana-de-açúcar, devendo-se aplicar técnicas intensivas de conservação, e com aptidão baseada em práticas agrícolas que refletem um alto nível tecnológico.
Resumo:
Foram estudados, com o auxílio de fotografias aéreas, aspectos qualitativos e quantitativos do relevo e da rede de drenagem de solos de uma área de Santa Bárbara D'Oeste, SP. Esta região compreende 14.625 ha, onde foram selecionadas bacias hidrográficas de 3ª ordem de ramificação e amostras circulares de 5km². As unidades de mapeamento simples ou associações de solos são: Latossolo Vermelho Escuro, Podzólico, Litossolo + Podzólico, Terra Roxa Estruturada + Latossolo Roxo distrófico. Após a caracterização das feições fisiográficas, da área de ocorrência desses solos, foram realizados dois mapas morfopedológicos. No primeiro utilizou-se fotografias aéreas verticais pancromáticas na escala 1: 35.000 (data de 25/6/78) e no segundo imagens orbitais do sensor Thematic Mapper do LANDSAT-5, nas bandas 3, 4 e 5 e composição colorida 3/4/5 na escala 1: 100.000 (data de 12/9/91). As análises qualitativas e quantitativas do relevo (índice de declividade média) e rede de drenagem (densidade de drenagem, freqüência de rios, razão de textura) mostraram-se eficientes na diferenciação das unidades de solo estudadas, tanto em bacias hidrográficas como em amostras circulares. A utilização de fotografias aéreas, permitiu maior riqueza de detalhes na precisão dos limites das unidades de mapeamento e no maior número de unidades de mapeamento discriminadas em relação as imagens orbitais. A composição colorida 3/4/5 permitiu diferenciar os Latossolos argilosos dos Latossolos de textura média, assim como o Latossolo Húmico.
Resumo:
Imagens CCD/CBERS-2, nas bandas espectrais CCD2, CCD3 e CCD4, dos anos de 2004 e 2005, de Mirante do Paranapanema - SP, foram transformadas em reflectância de superfície usando o modelo 5S de correção atmosférica e normalizadas radiometricamente. O objetivo principal foi caracterizar espectralmente áreas de pastagens de Brachiaria brizantha em fase de florescimento, isentas e infectadas com a doença mela-das-sementes da braquiária, possibilitando a sua detecção por meio da comparação entre os valores de reflectância de superfície denominada de Fator de Reflectância Bidirecional de Superfície (FRBS). Teve-se, também, o objetivo de avaliar a eficácia das imagens CCD/CBERS-2 para a obtenção de respostas espectrais de pastagens. Os dosséis sadios e doentes da Brachiaria brizantha foram identificados por meio da análise dos valores de reflectância e dos dados observados no Índice de Estresse Hídrico Acumulativo Relativo da Cultura (ACWSI) obtidos na área de estudo. Os resultados indicaram que as principais diferenças foram a diminuição da reflectância na banda CCD3 e o aumento da reflectância na banda CCD4 nas áreas doentes. A metodologia empregada com o uso de dados do sensor CCD/CBERS-2, associados ao ACWSI, mostrou-se eficaz para discriminar dosséis infectados com a mela-das-sementes da braquiária.
Resumo:
The aim of this study was to analyze the reproducibility of the electromyography signal's parameters (EMG) in the frequency domain used in the characterization of localized muscle fatigue. Fifteen male subjects underwent a fatigue test based on isometric knee extension, being held at three different times at intervals of seven days. To assess the reproducibility of data between the tests we calculated the correlation coefficient (ICC) for the median frequency (MF) in total exercise time (MFT), MF obtained for every 10% of exercise time (MF10%) and the powers of the frequency bands obtained by dividing the power spectrum at windows of 20 Hz. The results showed: (1) excellent reproducibility for MFT, (2) good reproducibility for MF10%, and (3) greater variation in the signal EMG bands from 20 to 120 Hz, especially at the bands of 20-40 Hz and 40-60 Hz, which showed greater sensitivity to the process of muscle fatigue. We conclude that the MF is a variable that shows good reproducibility and that the fragmented analysis of the power spectrum, by means of frequency bands, showed that significant variations occur in the EMG signal during the installation of the fatigue process, having potential to become a new method for the characterization of localized muscle fatigue.
Resumo:
Molecular typing and virulence markers were used to evaluate the genetic profiles and virulence potential of 106 Yersinia enterocolitica strains. of these strains, 71 were bio-serotype 4/O: 3, isolated from human and animal clinical material, and 35 were of biotype 1 A or 2 and of diverse serotypes, isolated from food in Brazil between 1968 and 2000. Drug resistance was also investigated. All the strains were resistant to three or more drugs. The isolates showed a virulence-related phenotype in the aesculin, pyrazinamidase and salicin tests, except for the food isolates, only two of which were positive for these tests. For the other phenotypic virulence determinants (autoagglutination, Ca++ dependence and Congo red absorption), the strains showed a diverse behaviour. The inv, ail and ystA genes were detected in all human and animal strains, while all the food isolates were positive for inv, and 3% of them positive for ail and ystA. The presence of virF was variable in the three groups of strains. The strains were better discriminated by PFGE than by enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). A higher genomic similarity was observed among the 4/O: 3 strains, isolated from human and animal isolates, than among the food strains, with the exception of two food strains possessing the virulence genes and grouped close to the 4/O: 3 strains by ERIC-PCR. Unusually, the results revealed the virulence potential of a bio-serotype 1 A/O: 10 strain, suggesting that food contaminated with Y. enterocolitica biotype 1 A may cause infection. This also suggests that ERIC-PCR may be used as a tool to reveal clues about the virulence potential of Y. enterocolitica strains. Furthermore, the results also support the hypothesis that animals may act as reservoirs of Y. enterocolitica for human infections in Brazil, an epidemiological aspect that has not been investigated in this country, confirming data from other parts of the world.
Resumo:
We study the optical-phonon spectra in periodic and quasiperiodic (Fibonacci type) superlattices made up from III-V nitride materials (GaN and AlN) intercalated by a dielectric material (silica - SiO2). Due to the misalignments between the silica and the GaN, AlN layers that can lead to threading dislocation of densities as high as 1010 cm−1, and a significant lattice mismatch (_ 14%), the phonon dynamics is described by a coupled elastic and electromagnetic equations beyond the continuum dielectric model, stressing the importance of the piezoelectric polarization field in a strained condition. We use a transfer-matrix treatment to simplify the algebra, which would be otherwise quite complicated, allowing a neat analytical expressions for the phonon dispersion relation. Furthermore, a quantitative analysis of the localization and magnitude of the allowed band widths in the optical phonon s spectra, as well as their scale law are presented and discussed
Resumo:
No presente estudo procedeu-se ao isolamento e caracterização da fração globulina majoritária (11 S) de grão-de-bico, var. IAC-Marrocos. A globulina majoritária extraída foi isolada por cromatografia de filtração em gel e de troca-iônica mostrando apenas uma banda de proteína na eletroforese em gel de poliacrilamida. A globulina majoritária, após passagem em coluna de Sephadex, revelou duas bandas protéicas de 55 e 52,5kDa e três bandas menores em gel de poliacrilamida dodecilsulfato de sódio. Na presença de 2-mercaptoetanol 6 polipeptídios na faixa de 18 a 42kDa foram revelados na eletroforese. A globulina isolada foi submetida à ação da tripsina e quimotripsina onde a forma nativa mostrou-se resistente à ação enzimática enquanto o aquecimento (96 e 121°C/15min) não foi suficiente para aumentar a susceptibilidade à hidrólise, significativamente. Adição de NaCl 0,3M levou a um aumento da estabilidade estrutural com menor susceptibilidade à digestão proteolítica, fato em parte perdido com o aquecimento. As hidrólises foram acompanhadas por eletroforese em gel de poliacrilamida dodecilsulfato de sódio.
Resumo:
A germinação das sementes de grão-de-bico foi acompanhada por um período de 6 dias, no qual pequenas variações nos teores de nitrogênio e globulina total foram registradas. A globulina majoritária (tipo 11 S) apresentou maiores variações após o quarto dia de germinação. A natureza e distribuição da fração globulina majoritária isolada na cromatografia em Sepharose CL-6B mostrou pequenas modificações ao final do período de germinação. A eletroforese em gel de poliacrilamida com dodecilssulfato de sódio do pico eluído na cromatografia em Sepharose CL-6B demonstra modificações nas bandas de proteínas entre os pesos moleculares de 20 e 30 kDa e acima de 60 kDa, indicando degradação protéica durante o período. Atividade proteolítica foi detectada na fração albumina da semente que aumentou até o quarto dia, seguido de queda até o sexto dia de germinação, quando da utilização de globulina total isolada da semente e caseína como substratos. Farinha de grão-de-bico, frações albumina e globulina total isoladas não apresentaram aumento na digestibilidade in vitro; entretanto, a fração globulina majoritária isolada foi mais suscetível à hidrólise após germinação.
Resumo:
Mira and R Coronae Borealis (R CrB) variable stars are evolved objects surrounded by circumstellar envelopes (CSE) composed of the ejected stellar material. We present a detailed high-spatial resolution morfological study of the CSE of three stars: IRC+10216, the closest and more studied Carbon-Rich Mira; o Ceti, the prototype of the Mira class; and RY Sagitarii (RY Sgr), the brightest R CrB variable of the south hemisphere. JHKL near-infrared adaptive optics images of IRC+10216 with high dynamic range and Vband images with high angular resolution and high depth, collected with the VLT/NACO and VLT/FORS1 instruments, were analyzed. NACO images of o Ceti were also analyzed. Interferometric observations of RY Sgr collected with the VLTI/MIDI instrument allowed us to explore its CSE innermost regions (»20 40 mas). The CSE of IRC+10216 exhibit, in near-infrared, clumps with more complex relative displacements than proposed in previous studies. In V-band, the majority of the non-concentric shells, located in the outer CSE layers, seem to be composed of thinner elongated shells. In a global view, the morphological connection between the shells and the bipolar core of the nebulae, located in the outer layers, together with the clumps, located in the innermost regions, has a difficult interpretation. In the CSE of o Ceti, preliminar results would be indicating the presence of possible clumps. In the innermost regions (.110 UA) of the CSE of RY Sgr, two clouds were detected in different epochs, embedded in a variable gaussian envelope. Based on a rigorous verification, the first cloud was located at »100 R¤ (or »30 AU) from the centre, toward the east-north-east direction (modulo 180o) and the second one was almost at a perpendicular direction, having aproximately 2£ the distance of the first cloud. This study introduces new constraints to the mass-loss history of these kind of variables and to the morphology of their innermost CSE regions