Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Novel mutations of the BSCL2 and AGPAT2 genes in 10 families with Berardinelli-Seip congenital generalized lipodystrophy syndrome

P>Context Congenital generalized lipodystrophy, or Berardinelli-Seip syndrome, is a rare autosomal recessive disease caused by mutations in either the BSCL2 or AGPAT2 genes. This syndrome is characterized by an almost complete loss of adipose tissue usually diagnosed at birth or early infancy resulting in apparent muscle hypertrophy. Common clinical features are acanthosis nigricans, hepatomegaly with or without splenomegaly and high stature. Acromegaloid features, cardiomyopathy and mental retardation can also be present. Design We investigated 11 kindreds from different geographical areas of Brazil (northeast and southeast). All coding regions as well as flanking intronic regions of both genes were examined. Polymerase chain reaction (PCR) amplifications were performed using primers described previously and PCR products were sequenced directly. Results Four AGPAT2 and two BSCL2 families harboured the same set of mutations. BSCL2 gene mutations were found in the homozygous form in four kindreds (c.412C > T c.464T > C, c.518-519insA, IVS5-2A > G), and in two kindreds compound mutations were found (c.1363C > T, c.424A > G). In the other four families, one mutation of the AGPAT2 gene was found (IVS3-1G > C and c.299G > A). Conclusions We have demonstrated four novel mutations of the BSCL2 and AGPAT2 genes responsible for Berardinelli-Seip syndrome and Brunzell syndrome (AGPAT2-related syndrome).

Mutations of the thyroglobulin gene and its relevance to thyroid disorders

Purpose of review To perform an update review on thyroglobulin gene mutations associated with congenital hypothyroidism, thyroid cancer, and autoimmunity. Recent findings Forty-two thyroglobulin mutations have been identified in dyshormonogenetic congenital hypothyroidism. Clinical and laboratory criteria defining defective thyroglobulin synthesis are mostly related to thyroglobulin mutations, generally caused by intracellular thyroglobulin transport defects to the colloid rather than defects in thyroid hormones synthesis. Some mutated thyroglobulin may escape the rigorous chaperone control and reach the colloid, allowing a wide phenotypic spectrum that includes euthyroidism in an adequate iodine environment. In some patients, continuous levothyroxine treatment does not reduce elevated serum thyroid-stimulating hormone (TSH) levels that may lead to goiter development. Prenatally, inactive mutant thyroglobulin will not be able to synthesize thyroid hormones and may increase pituitary thyrotroph threshold for thyroid hormone feedback. Congenital goiter is a risk factor for thyroid cancer and some thyroglobulin variants may confer susceptibility to thyroid autoimmunity. Summary Advances in the understanding of thyroglobulin genetic defects and its severity should allow researchers to perform adequate molecular diagnosis, genetic counseling, and intrauterine treatment to prevent subtle deficits in central nervous system development. This knowledge should improve the understanding of physiological functions of the thyroid and influence of nutritional iodine.

The shoot controls zeatin riboside export from pea roots. Evidence from the branching mutant rms4

The rms4 mutant of pea (Pisum sativum L.) was used in grafting studies and cytokinin analyses of the root xylem sap to provide evidence that, at least for pea, the shoot can modify the import of cytokinins from the root. The rms4 mutation, which confers a phenotype with increased branching in the shoot, causes a very substantial decrease (down to 40-fold less) in the concentration of zeatin riboside (ZR) in the xylem sap of the roots. Results from grafts between wild-type (WT) and rms4 plants indicate that the concentration of cytokinins in the xylem sap of the roots is determined almost entirely by the genotype of the shoot. WT scions normalize the cytokinin concentration in the sap of rms4 mutant roots, whereas mutant scions cause WT roots to behave like those of self-grafted mutant plants. The mechanism whereby rms4 shoots of pea cause a down-regulation in the export of cytokinins from the roots is unknown at this time. However, our data provide evidence that the shoot transmits a signal to the roots and thereby controls processes involved in the regulation of cytokinin biosynthesis in the root.

Mutational analysis of the necdin gene in patients with congenital isolated hypogonadotropic hypogonadism

Context: Necdin activates GNRH gene expression and is fundamental for the development, migration, and axonal extension of murine GNRH neurons. In humans, necdin plays a potential role in the hypogonadotropic hypogonadism phenotype in patients with Prader-Willi syndrome. Aim: To investigate necdin gene (NDN) variants in patients with isolated hypogonadotropic hypogonadism (IHH). Patients and methods: We studied 160 Brazilian patients with IHH, which includes 92 with Kallmann syndrome and 68 with normosmic IHH. Genomic DNA was extracted and the single NDN exon was amplified and sequenced. To measure GNRH transcriptional activity, luciferase reporter plasmids containing GNRH regulatory regions were transiently transfected into GT1-7 cells in the presence and absence of overexpressed wild-type or mutant necdin. Results: A heterozygous variant of necdin, p.V318A, was identified in a 23-year-old male with Kallmann syndrome. The p.V318A was also present in affected aunt and his father and was absent in 100 Brazilian control subjects. Previous FGFR1 gene analysis revealed a missense mutation (p.P366L) in this family. Functional studies revealed a minor difference in the activation of GNRH transcription by mutant protein compared with wild type in that a significant impairment of the necdin protein activity threshold was observed. Conclusion: A rare variant of necdin (p.V318A) was described in a family with Kallmann syndrome associated with a FGFR1 mutation. Familial segregation and in vitro analysis suggested that this non-synonymous variant did not have a direct causative role in the hypogonadism phenotype. NDN mutations are not a frequent cause of congenital IHH.

Pollymorphisms in the CBS Gene and Homocysteine, Folate and Vitamin B(12) Levels: Association With Polymorphisms in the MTHFR and MTRR Genes in Brazilian Children

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.

Spectrum and Prevalence of FP/TMEM127 Gene Mutations in Pheochromocytomas and Paragangliomas

Context Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. Objectives To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. Design, Setting, and Participants We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. Main Outcome Measures The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. Results We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P=2.7 x 10(-4)) and/or with familial disease (5 of 20 samples; P=.005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P=.54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Conclusions Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occured in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein. JAMA. 2010;304(23):2611-2619 www.jama.com

Zipping up transcription factors: Rational design of anti-Jun and anti-Fos peptides

Various members of the bZip and bHLH-Zip families of eukaryotic transcription factors, including Jun, Fos, and Myc, have been identified as oncoproteins; mutation or deregulated expression of these proteins leads to certain types of cancer. These proteins can only bind to their cognate DNA enhancer sites following homodimerization, or heterodimerization with another family member, via their leucine zipper domain. Thus, a novel anticancer strategy would be to inhibit dimerization of these proteins, thereby blocking their DNA binding and transactivation functions. In this paper we show that it is possible to rationally design leucine zipper peptides that bind with high affinity to the leucine zipper dimerization domains of c-Jun and c-Fos, thus preventing the formation of functional c-Jun homodimers and c-Jun:c-Fos heterodimers; we refer to such peptides as superzippers (SZs). In vivo, c-Jun:SZ and c-Fos:SZ heterodimers should be nonfunctional as they lack one of the two basic domains that are essential for DNA binding. While the transport of a peptidic agent into cells often poses a severe obstacle to its therapeutic use, we show that a 46-residue leucine zipper peptide can be transported into HeLa cells by coupling it to a 17-residue carrier peptide from the Antennapedia homeodomain, thus paving the way for detailed studies of the therapeutic potential of superzipper peptides.

Characterisation of five missense mutations in the cystathionine beta-synthase gene from three patients with B-6-nonresponsive homocystinuria

Homocystinuria, due to a deficiency of the enzyme cystathionine beta-synthase (CBS), is an inborn error of sulphur-amino acid metabolism, This is an autosomal recessive disease which results in hyperhomocysteinaemia and a wide range of clinical features, including optic lens dislocation, mental retardation, skeletal abnormalities and premature thrombotic events, We report the identification of 5 missense mutations in the protein-coding region of the CBS gene from 3 patients with pyridoxine-nonresponsive homocystinuria. Reverse-transcription PCR was used to amplify CBS cDNA from each patient and the coding region was analysed by direct sequencing, The mutations detected included 3 novel (1058C --> T, 992C --> A and 1316G --> A) and 2 previously identified (430G --> A and 833C --> T) base alterations in the CBS cDNA, Each of these mutations predicts a single amino acid substitution in the CBS polypeptide, Appropriate cassettes of patient CBS cDNA, containing each of the above defined mutations, were used to replace the corresponding cassettes of normal CBS cDNA sequence within the bacterial expression vector pT7-7. These recombinant mutant and normal CBS constructs were expressed in Escherichia coli cells and the catalytic activities of the mutant proteins were compared with normal. All of the mutant proteins exhibited decreased catalytic activity in vitro, which confirmed the association between the individual mutation and CBS dysfunction in each patient.

Characterization of high density lipoprotein particles in familial apolipoprotein A-I deficiency

Our aim was to characterize HDL subspecies and fat-soluble vitamin levels in a kindred with familial apolipoprotein A-I (apoA-I) deficiency. Sequencing of the APOA1 gene revealed a nonsense mutation at codon 22, Q[22] X, with two documented homozygotes, eight heterozygotes, and two normal subjects in the kindred. Homozygotes presented markedly decreased HDL cholesterol levels, undetectable plasma apoA-1, tuboeruptive and planar xanthomas, mild corneal arcus and opacification, and severe premature coronary artery disease. In both homozygotes, analysis of HDL particles by two-dimensional gel electrophoresis revealed undetectable apoA-I, decreased amounts of small a-3 migrating apoA-II particles, and only modestly decreased normal amounts of slow a migrating apoA-IV- and apoE-containing HDL, while in the eight heterozygotes, there was loss of large alpha-1 HDL particles. There were no significant decreases in plasma fat-soluble vitamin levels noted in either homozygotes or heterozygotes compared with normal control subjects. Our data indicate that isolated apoA-I deficiency results in marked HDL deficiency with very low apoA-II alpha-3 HDL particles, modest reductions in the separate and distinct plasma apoA-IV and apoE HDL particles, tuboeruptive xanthomas, premature coronary atherosclerosis, and no evidence of fat malabsorption.

NKX2.5 mutations in patients with non-syndromic congenital heart disease

Background: Cardiac development is a complex and multifactorial biological process. Heterozygous mutations in the transcription factor NKX2.5 are between the first evidence of a genetic cause for congenital heart defects in human beings. In this study, we evaluated the presence and frequency of mutations in the NKX2.5 gene on 159 unrelated patients with a diverse range of non-syndromic congenital heart defects (conotruncal anomalies, septal defects, left-sided lesions, right-sided lesions, patent ductus arteriosus and Ebstein`s anomaly). Methods: The coding region of the NKX2.5 locus was amplified by polymerase chain reaction and mutational analysis was performed using denaturing high performance liquid chromatography (DHPLC) and DNA sequencing. Results: We identified two distinct mutations in the NKX2.5 coding region among the 159 (1.26%) individuals evaluated. An Arg25Cys mutation was identified in a patient with Tetralogy of Fallot. The second mutation found was an Ala42Pro in a patient with Ebstein`s anomaly. Conclusions: The association of NKX2.5 mutations is present in a small percentage of patients with non-syndromic congenital heart defects and may explain only a few cases of the disease. Screening strategies considering the identification of germ-line molecular defects in congenital heart disease are still unwarranted and should consider other genes besides NKX2.5. (C) 2008 Elsevier Ireland Ltd. All rights reserved.

Frequency of 22q11.2 microdeletion in sporadic non-syndromic tetralogy of Fallot cases

Background: Tetralogy of Fallot (TOF) is a congenital conotruncal heart defect commonly found in DiGeorge (DGS) and velocardiofacial (VCFS) syndromes. The deletion of chromosome 22q11 has also been demonstrated in sporadic or familial cases of TOF. The aim of the present study was to investigate the frequency of del22q11 in patients with non-syndromic TOF seen at a tertiary Pediatric Cardiology care center. Method: One hundred and twenty three non-syndromic TOF patients were selected and evaluated by history, physical examination and review of medical records. Venous blood was drawn for genomic DNA extraction after informed consent 22q11 microdeletion diagnosis was conducted through a standardized SNP genotyping assay and consecutive homozygosity mapping. Phenotype-genotype correlations regarding cardiac anatomy were conducted. Results: We evaluated 123 non-syndromic TOF patients for a 22q11 deletion. 105 (85.4%) patients presented pulmonary stenosis and 18 (14.6%) had pulmonary atresia. Eight patients (6.5%) were found to have a deletion. Of the deleted patients, three (37.5%) presented pulmonary atresia. We have verified a tendency towards a higher prevalence of pulmonary atresia when comparing TOF patients with and without 22q11 microdeletion. Conclusions: 22q11.2 deletion in non-syndromic TOF patients is present in approximately 6% of patients. We suggest a tendency towards a higher prevalence of pulmonary atresia in non-syndromic TOF patients with 22q11 microdeletion. Molecular genetic screening of non-syndromic TOF patient may be important for the correct care of these patients and a more specific genetic diagnostic and counseling. (C) 2007 Elsevier Ireland Ltd. All rights reserved.

Structural analysis of three His32 mutants of DsbA: Support for an electrostatic role of His32 in DsbA stability

DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.

PTCH1 gene mutations in exon 17 and loss of heterozygosity on D9S180 microsatellite in sporadic and inherited human basal cell carcinomas

Background Basal cell carcinomas (BCCs) are the most frequent human cancer that results from malignant transformation of basal cells in the epidermis. Gorlin syndrome is a rare inherited autosomal dominant disease that predisposes with multiple BCCs and other birth defects. Both sporadic and inherited BCCs are associated with mutations in the tumor suppressor gene PTCH1, but there is still uncertainty on the role of its homolog PTCH2. Objectives To search for mutations and genomic instability in sporadic and inherited BCCs. Methods DNA obtained from leukocytes and tumor cells was amplified by polymerase chain reaction regarding five exons of PTCH1 and PTCH2 and neighboring microsatellites. Exons were sequenced and compared with the GenBank database. Results Only D9S180, of six microsatellites, showed loss of heterozygosity in three BCCs (two sporadic and one inherited). One sporadic BCC presented the mutation g. 2885G>C in exon 17 of PTCH1, which predicts the substitution p.R962T in an external domain of the protein. In addition, the leukocytes and tumor cells of one patient with Gorlin syndrome showed the mutation g. 2839T>G in the same exon and gene, which predicts a p.E947stop and truncated protein. All control and tumor samples presented IVS9 + 217T in intron 9 of PTCH1. Conclusion Mutations found in the PTCH1 gene and neighboring repetitive sequences may have contributed to the development of the studied BCCs.

Colorectal cancer in familial adenomatous polyposis: Are there clinical predictive factors?

Background: Familial Adenomatous Polyposis (FAP) is a hereditary disorder with multiple colorectal polyps that exhibit an almost inevitable risk of colorectal cancer (CRC) in untreated patients. Goals: To evaluate clinical features related to CRC risk at diagnosis. Material and methods: Charts from 88 patients were reviewed to collect information regarding age, family history, symptoms, polyposis severity and association with CRC. Results: 41 men (46.6%) and 47 women (53.4%) were assisted. CRC was detected in 53 patients (60.2%), with a frequency of 9.1% under 20 years, 58% between 21-40 and 85% over 41 years of age. Average age of patients without CRC was lower at treatment (29.5 vs. 40.0 years; p=0.001). Family history was reported by 58 patients (65.9%), whose average age did not differ from those who didn`t report it (33.4 vs. 34.4; p=0.17). Asymptomatic patients comprised 10.2% of the total; in this group, CRC incidence was much lower when compared to those presenting symptoms (1.1% vs. 65.8%; p=0.001). Patients without CRC presented a shorter length of symptoms (15.2 vs. 26.4 months; p=0.03) and less frequent weight loss (11.4% vs. 33.9%; p=0.01). At colonoscopy, polyposis was classified as attenuated in 12 patients (14.3%), who presented greater average age (48.2 vs. 33.3 years; p=0.02) and equal CRC incidence (58.3% vs. 58.3%; p=0.6) when compared to those with classic polyposis. Conclusions: The risk of CRC in FAP patients 1) increases significantly after the second decade; 2) is associated with higher age, weight loss, presence and duration of simptomatology; 3) is similar in patients with attenuated or classic phenotype. (C) 2010 AEC. Published by Elsevier Espana, S.L. All rights reserved.