Introduction of 4-chloro-alpha-cyanocinnamic acid liquid matrices for high sensitivity UV-MALDI MS

Matrix-assisted laser desorption/ionization (MALDI) is a key ionization technique in mass spectrometry (MS) for the analysis of labile macromolecules. An important area of study and improvements in relation to MALDI and its application in high-sensitivity MS is that of matrix design and sample preparation. Recently, 4-chloro-alpha-cyanocinnamic acid (ClCCA) has been introduced as a new rationally designed matrix and reported to provide an improved analytical performance as demonstrated by an increase in sequence coverage of protein digests obtained by peptide mass mapping (PMM) (Jaskolla, T. W.; et al. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 12200-12205). This new matrix shows the potential to be a superior alternative to the commonly used and highly successful alpha-cyano-4-hydroxycinnamic acid (CHCA). We have taken this design one step further by developing and optimizing an ionic liquid matrix (ILM) and liquid support matrix (LSM) using ClCCA as the principle chromophore and MALDI matrix compound. These new liquid matrices possess greater sample homogeneity and a simpler morphology. The data obtained from our studies show improved sequence coverage for BSA digests compared to the traditional CHCA crystalline matrix and for the ClCCA-containing ILM a similar performance to the ClCCA crystalline matrix down to 1 fmol of BSA digest prepared in a single MALDI sample droplet with current sensitivity levels in the attomole range. The LSMs show a high tolerance to contamination such as ammonium bicarbonate, a commonly used buffering agent.

Platelet adhesion to collagen and collagen-related peptide under flow. Roles of the alpha(2)beta(1) integrin, GPVI, and Src tyrosine kinases

Objective - Platelet stimulation by collagen and collagen-related peptides (CRPs) is associated with activation of protein tyrosine kinases. In the present study, we investigated the role of Src family tyrosine kinases in the initial adhesion events of human platelets to collagen and cross-linked CRP. Methods and Results - Under arterial flow conditions, a glycoprotein VI - specific substrate, cross-linked CRP, caused rapid (<2 second) platelet retention and protein tyrosine phosphorylation that were markedly decreased by the Src family kinase inhibitor pyrozolopyrimidine (PP2) or by aggregation inhibitor GRGDSP. CRP-induced platelet retention was transient, and 90% of single platelets or aggregates detached within seconds. PP2, although having no effect on RGD peptide-binding to CRP, completely blocked aggregation and tyrosine phosphorylation of Syk and phospholipase Cγ2 (PLCγ2). In contrast, PP2 weakly (<30%) suppressed firm adhesion to collagen mediated primarily by the alpha(2)beta(1) integrin. Although PP2 prevented activation of Syk and PLCgamma2 in collagen-adherent platelets, tyrosine phosphorylation of several unidentified protein bands persisted, as did autophosphorylation of pp125(FAK). Conclusions - These findings indicate that activation of Src-tyrosine kinases Syk and PLCgamma2 is not required for the initial stable attachment of human platelets to collagen and for FAK autophosphorylation. However, Src-tyrosine kinases are critical for glycoprotein VI - mediated signaling leading to platelet aggregation.

Hydrothermal synthesis and structural characterization of novel alpha-Keggin unit-supported Cu(II)- and Mn(II)-bipyridine complexes from a tri-lacunary precursor

Blue [{Cu(2,2'-bipy)(2)}(2){alpha-SiW12O40}] (bipy = bipyridyl) (1) and pale yellow [Mn(2,2'-bipy)(3)](2)[alpha-SiW12O40] (2) have been synthesized hydrothermally and characterized by IR spectroscopy and single crystal X-ray structure analysis. In 1, the [alpha-SiW12O40](4-) ion acts as a bridge between the two [{Cu(2,2'-bipy)(2)](2+) moieties via coordination through the terminal oxygen atoms, while in 2, the [Mn(2,2'-bipy)(3)](2+) ion balances the charge on the polyoxo anion without forming any covalent bond. To the best of our knowledge, this is the first example of transition metal-mediated transformation of [alpha-SiW9O34](10-) to [alpha-SiW12O40](4-).

Can a consecutive double turn conformation be considered as a peptide based molecular scaffold for supramolecular helix in the solid state?

Helices and sheets are ubiquitous in nature. However, there are also some examples of self-assembling molecules forming supramolecular helices and sheets in unnatural systems. Unlike supramolecular sheets there are a very few examples of peptide sub-units that can be used to construct supramolecular helical architectures using the backbone hydrogen bonding functionalities of peptides. In this report we describe the design and synthesis of two single turn/bend forming peptides (Boc-Phe-Aib-Ile-OMe 1 and Boc-Ala-Leu-Aib-OMe 2) (Aib: alpha-aminoisobutyric acid) and a series of double-turn forming peptides (Boc-Phe-Aib-IIe-Aib-OMe 3, Boc-Leu-Aib-Gly-Aib-OMe 4 and Boc-gamma-Abu-Aib-Leu-Aib-OMe 5) (gamma-Abu: gamma-aminobutyric acid). It has been found that, in crystals, on self-assembly, single turn/bend forming peptides form either a supramolecular sheet (peptide 1) or a supramolecular helix (peptide 2). unlike self-associating double turn forming peptides, which have only the option of forming supramolecular helical assemblages. (c) 2005 Elsevier Ltd. All rights reserved.

21-Deoxycortisone (17 alpha-hydroxy4-pregnene-3,11,20-trione)

The title compound, C21H28O4, a synthetic glucocorticoid, crystallizes with a single molecule in the asymmetric unit. Ring A is almost in a half-chair conformation, rings B and C are almost in chair conformations, and ring D is between a twist and a 13 beta-envelope conformation. The A/B ring junction is quasi-trans, whereas the B/C and C/D ring junctions both approach trans characteristics. The molecule as a whole is slightly convex towards the beta side, with an angle of 9.60 (2)degrees between the C10-C19 and C13-C18 vectors. Molecular-packing and hydrogen-bonding (both intra- and inter-molecular) interactions play a major role in the structural association of the compound.

Conformational and self-assembly studies of helix forming hexapeptides containing two alpha-amino isobutyric acids

Single crystal X-ray diffraction studies reveal that three hexapeptides with general formula Boc-Ile-Aib-Xx-Ile-Aib-Yy-OMe, where Xx and Yy are Leu in peptide I, Len and Phe in peptide II, and Phe and Leu in peptide III, respectively, adopt equivalent conformations that can be described as mixed 3(10)/alpha-helice with two 4 -> 1 and two 5 -> 1 intramolecular N-H center dot center dot center dot O=C H-bonds. The peptides do not generate any helixterminating Schellman motif despite having Aib at the penultimate position from C-terminus. In the crystalline state, the helices are packed in head-to-tail fashion through intermolecular hydrogen bonds to create supramolecular helical structures. The CD Studies of the three hexapeptides in acetonitrile indicate that they are folded in well-developed 3(10)-helical structures. NMR studies of peptide I in CDCl3 also suggest the formation of a homogeneous 3 m-helical structure. The field emission scanning electron microscopic (FE-SEM) images of peptide 11 in the solid state reveal a non-twisted ribbon-like morphology, which is formed through lateral association of non-twisted filaments. (c) 2007 Elsevier Ltd. All rights reserved.

Stabilization of two smallest possible diastereomeric beta-hairpins in a water soluble tetrapeptide containing non-coded alpha-amino isobutyric acid (Aib) and m-amino benzoic acid

Single crystal X-ray diffraction study reveals that the water soluble tetrapeptide H2N-Ile-Aib-Leu-m-ABA-CO2H, containing non-coded Aib (alpha-amino isobutyric acid) and m-ABA (meta-amino benzoic acid), crystallizes with two smallest possible diastereomeric beta-hairpin molecules in the asymmetric unit. Although in both of the molecules the chiralities at Ile(1) and Leu(3) are S, a conformational reversal in the back bone chain is observed to produce the beta-hairpins with beta-turn conformations of type II and II'. Interestingly Aib which is known to adopt helical conformation, adopts unusual semi-extended conformation with phi: -49.5(5)degrees, psi: 135.2(5)degrees in type II and phi: 50.6(6)degrees. psi: -137.0(4)degrees in type II' for occupying the i + 1 position of the beta-turns. The two hairpin molecules are further interlocked through intermolecular hydrogen bonds and electrostatic interactions between CO2- and -+NH3 groups to form dimeric supramolecular beta-hairpin aggregate in the crystal state. The CD measurement and 2D NMR study of the peptide in aqueous medium support the existence of beta-hairpin structure in water. (C) 2009 Elsevier B.V. All rights reserved.

Overlapping double turn conformations adopted by tetrapeptides containing non-coded alpha-Amino Isobutyric Acid (AIB) and formation of tape-like structures through supramolecular helix mediated self-assembly

Single crystal X-ray diffraction studies and solvent dependent H-1 NMR titrations reveal that a set of four tetrapeptides with general formula Boc-Xx(1)-Aib(2)-Yy(3)-Zz(4)-OMe, where Xx, Yy and Zz are coded L- amino acids, adopt equivalent conformations that can be described as overlapping double turn conformations stabilized by two 4 -> 1 intramolecular hydrogen bonds between Yy(3)-NH and Boc C=O and Zz(4)-NH and Xx(1)C=O. In the crystalline state, the double turn structures are packed in head-to-tail fashion through intermolecular hydrogen bonds to create supramolecular helical structures. Field emission scanning electron microscopic (FE-SEM) images of the tetrapeptides in the solid state reveal that they can form flat tape-like structures. The results establish that synthetic Aib containing supramolecular helices can form highly ordered self-aggregated amyloid plaque like human amylin.

Design of supramolecular beta-sheet forming beta-turns containing aromatic rings and non-coded alpha-aminoisobutyric acid and the formation of flat fibrillar structures through self-assembly

Single crystal X-ray diffraction studies show that the three designed tripeptides Boc-Leu-Aib-m-NA-NO2 (I), Boc-Phe-Aib-m-NA-NO2 (II) and Boc-Pro-Aib-m-ABA-OMe (III) (Aib, -aminoisobutyric acid; m-NA, m-nitroaniline; m-ABA, m-aminobenzoic acid; Boc, t-butyloxycarbonyl) containing aromatic rings in the backbones adopt -turn structures that are self-assembled through intermolecular hydrogen bonds and van der Waals interactions to create layers of -sheets. Solvent-dependent NMR titration and CD studies show that the -turn structures of the peptides also exist in the solution phase. The field emission scanning electron microscopic and transmission electron microscopic images of the peptides in the solid state reveal fibrillar structures of flat morphology that are formed through -sheet mediated self-assembly of the preorganised -turn building blocks.

Development of a liquid chromatographic time-of-flight mass spectrometric method for the determination of unlabelled and deuterium-labelled alpha-tocopherol in blood components

A method is described for the analysis of deuterated and undeuterated alpha-tocopherol in blood components using liquid chromatography coupled to an orthogonal acceleration time-of-flight (TOF) mass spectrometer. Optimal ionisation conditions for undeuterated (d0) and tri- and hexadeuterated (d3 or d6) alpha-tocopherol standards were found with negative ion mode electrospray ionisation. Each species produced an isotopically resolved single ion of exact mass. Calibration curves of pure standards were linear in the range tested (0-1.5 muM, 0-15 pmol injected). For quantification of d0 and d6 in blood components following a standard solvent extraction, a stable-isotope-labelled internal standard (d3-alpha-tocopherol) was employed. To counter matrix ion suppression effects, standard response curves were generated following identical solvent extraction procedures to those of the samples. Within-day and between-day precision were determined for quantification of d0- and d6-labelled alpha-tocopherol in each blood component and both averaged 3-10%. Accuracy was assessed by comparison with a standard high-performance liquid chromatography (HPLC) method, achieving good correlation (r(2) = 0.94), and by spiking with known concentrations of alpha-tocopherol (98% accuracy). Limits of detection and quantification were determined to be 5 and 50 fmol injected, respectively. The assay was used to measure the appearance and disappearance of deuterium-labelled alpha-tocopherol in human blood components following deuterium-labelled (d6) RRR-alpha-tocopheryl acetate ingestion. The new LC/TOFMS method was found to be sensitive, required small sample volumes, was reproducible and robust, and was capable of high throughput when large numbers of samples were generated. Copyright (C) 2003 John Wiley Sons, Ltd.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Amyloid-like fibrillogenesis through supramolecular helix-mediated self-assembly of tetrapeptides containing non-coded alpha-aminoisobutyric acid (Aib) and 3-aminobenzoic acid (m-ABA)

Single-crystal X-ray diffraction studies of two terminally protected tetrapeptides Boc-Ile-Aib-Val-m-ABA-OMe (I) and Boc-Ile-Aib-Phe-m-ABA-OMe (II) (Aib = alpha-aminoisobutyric acid; m-ABA = meta-aminobenzoic acid) reveal that they form continuous H-bonded helices through the association of double-bend (type III and I) building blocks. NMR Studies support the existence of the double-bend (type Ill and I) structures of the peptides in solution also. Field emission scanning electron-microscopic (FE-SEM) and high-resolution transmission electron-microscopic (HR-TEM) images of the peptides exhibit amyloid-like fibrils in the solid state. The Congo red-stained fibrils of peptide I and II, observed between crossed polarizers, show green-gold birefringence, a characteristic of amyloid fibrils.

Sources of alpha and beta in property funds

This paper examines issues related to potential analytical performance systems for global property funds. These will include traditional attribution methods but will also cover the performance concepts of alpha and beta widely used in other asset classes. We look at issues including...what creates beta, and what drives alpha in real estate investment? How can it be measured and isolated? How do these concepts relate to traditional attribution systems? Can performance records and performance fees adequately distinguish between these drivers? In this paper we illustrate these issues by reference to a case study addressing the complete performance record of a single unlisted fund.

Effect of an ancillary ligand on single helix-double helix interconversion in copper complexes. Copper(I)-water bond

Reaction of Cu(ClO(4))(2)center dot 6H(2)O with the 1:2 condensate of benzildihydrazone and 2-acetylpyridine, in methanol in equimolar ratio yields a green compound which upon recrystallisation from 1:1 CH(2)Cl(2)-C(6)H(6) mixture affords [CuL(H(2)O)](ClO(4))(2)center dot 1/2C(6)H(6). The complex crystallises in the space group P-1 with a = 8.028(11) angstrom, b = 12.316(17) angstrom, c = 18.14(3) angstrom, alpha = 97.191(10)degrees, beta = 94.657(10)degrees and gamma = 108.039(10)degrees. It is single helical with the metal having a distorted trigonal bipyramidal N(4)O coordination sphere. The acid dissociation constant of the Cu(I) complex in CH(3)CN is 3.34 +/- 0.19. The X band EPR spectrum of the compound is rhombic with g(1) = 2.43, g(2) = 2.10 g(3) = 2.02 and A(1) = 79.3 x 10(-4) cm(-1). The Cu(II/I) potential of the complex in CH(2)Cl(2) at a glassy carbon electrode is 0.43 V vs SCE. It is argued that the copper-water bond persists in the corresponding copper(I) species. Its implications on the single helix-double helix interconversion in copper helicates are discussed. DFT calculations at the B3LYP/6-311G** level shows that the binding energy of water in the single helicol live-coordinate copper(I) species [CuL(H(2)O)](+) is similar to 40 kJ mol(-1).

Crystal design approaches for the synthesis of paracetamol co-crystals

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.