933 resultados para solicitor acting pro bono in litigious matter


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The discussion on the New Philology triggered by French and North American scholars in the last decade of the 20th century emphasized the material character of textual transmission inside and outside the written evidences of medieval manuscripts by downgrading the active role of the historical author. However, the reception of the ideas propagated by the New Philology adherents was rather divided. Some researchers considered it to be the result of an academic “crisis” (R.T. Pickens) or questioned its innovative status (K. Stackmann: “Neue Philologie?”); others appreciated the “new attitudes to the page” it had brought to mind (J. Bumke after R.H. and M.A, Rouse) or even saw a new era of the “powers of philology” evoked (H.-U. Gumbrecht). Besides the debates on the New Philology another concept of textual materiality strengthened in the last decade, maintaining that textual alterations somewhat relate to biogenetic mutations. In a matter of fact, phenomena such as genetic and textual variation, gene recombination and ‘contamination’ (the mixing of different exemplars in one manuscript text) share common features. The paper discusses to what extent the biogenetic concepts can be used for evaluating manifestations of textual production (as the approach of ‘critique génétique’ does) and of textual transmission (as the phylogenetic analysis of manuscript variation does). In this context yet the genealogical concept of stemmatology – the treelike representation of textual development abhorred by the New Philology adepts – might prove to be useful for describing the history of texts. The textual material to be analyzed will be drawn from the Parzival Project, which is currently preparing a new electronic edition of Wolfram von Eschenbach’s Parzival novel written shortly after 1200 and transmitted in numerous manuscripts up to the age of printing. Researches of the project have actually resulted in suggesting that the advanced knowledge of the manuscript transmission yields a more precise idea on the author’s own writing process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The discussion on the New Philology triggered by French and North American scholars in the last decade of the 20th century emphasized the material character of textual transmission inside and outside the written evidences of medieval manuscripts by downgrading the active role of the historical author. However, the reception of the ideas propagated by the New Philology adherents was rather divided. Some researchers questioned its innovative status (K. Stackmann: “Neue Philologie?”), others saw a new era of the “powers of philology” evoked (H.-U. Gumbrecht). Besides the debates on the New Philology another concept of textual materiality strengthened in the last decade, maintaining that textual alterations somewhat relate to biogenetic mutations. In a matter of fact, phenomena such as genetic and textual variation, gene recombination and ‘contamination’ (the mixing of different exemplars in one manuscript text) share common features. The paper discusses to what extent the biogenetic concepts can be used for evaluating manifestations of textual production (as the approach of ‘critique génétique’ does) and of textual transmission (as the phylogenetic analysis of manuscript variation does). In this context yet the genealogical concept of stemmatology – the treelike representation of textual development abhorred by the New Philology adepts – might prove to be useful for describing the history of texts. The textual material to be analyzed will be drawn from the Parzival Project, which is currently preparing a new electronic edition of Wolfram von Eschenbach’s Parzival novel written shortly after 1200 and transmitted in numerous manuscripts up to the age of printing (www.parzival.unibe.ch). Researches of the project have actually resulted in suggesting that the advanced knowledge of the manuscript transmission yields a more precise idea on the author’s own writing process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Einleitung: Im Zusammenhang mit der Leistungsdienlichkeit langer finaler Fixation (quiet eye, QE) wird vermutet, dass Leistungsverbesserungen nur für eine optimale Dauer zu beobachten sein sollten, also auch bei „überlangen“ QE-Dauern die Leistung wieder abnimmt (u.a. Janelle et al., 2000; Klostermann, 2014). Jedoch liegen zu dieser Vermutung bislang keine empirischen Befunde vor, so dass in der hier präsentierten Studie Präzisionsleistung in einer Wurfaufgabe in Abhängigkeit von (auch) sehr langen experimentell kontrollierten QE-Dauern untersucht wurde. Methode: In einem Within-subject-Design hatten 20 Sportstudierende unter acht verschiedenen QE-Bedingungen (Onset in 400-ms-Schritten von -3200 ms bis -400 ms vor Bewegungsbeginn; 16 Versuche pro Bedingung in randomisierter Abfolge) mit retro-reflektierenden Bällen auf eine Großleinwand projizierte Zielscheiben möglichst mittig zu treffen. Die QE-Manipulation erfolgte über eine an den Bewegungsbeginn gebundene Zielscheibeneinblendung samt Wurfrhythmisierung durch Tonvorgaben. Aus den mit einem Vicon-T20-System (200 Hz) sowie einem integrierten mobilen Eyetracker (EyeSeeCam, 220 Hz) erhobenen Daten wurden die QE-Dauer (ms) und die Wurfleistung (radialer Fehler, mm) als abhängige Variablen berechnet und varianzanalytisch auf Unterschiede untersucht. Resultate und Diskussion: Für die QE-Dauer wurde ein signifikanter Haupteffekt gefunden, F(7, 133) = 38.4, p < .01, ηp2 = .67, mit zumindest tendenziellen (-2000 ms vs. -2400 ms, -2800 ms vs. -3200 ms), größtenteils aber signifikanten QE-Anstiegen gemäß der experimentellen Manipulation (alle ps < .01), obgleich die jeweils angezielten QE-Dauern nicht erreicht und zum Teil deutlich unterschritten wurden (tatsächliche relativ zur angezielten Dauer im Mittel 59.95 %). Für den radialen Fehler ergab sich ein signifikanter Haupteffekt, F(7, 133) = 8.5, p < .01, ηp2 = .31, welcher durch signifikant schlechtere Leistungen bei den Onsets -400 ms und -800 ms gegenüber allen anderen Onsets erklärt wird (alle ps < .05; ausgenommen -400 ms vs. -800 ms und -800 ms vs. -2400 ms). Somit wurde der „klassische“ QE-Effekt schlechterer Leistungen infolge kurzer QE-Dauern repliziert; die Vermutung einer Leistungsverschlechterung bei überlangen QE-Dauern konnte jedoch – zumindest unter den infolge der Manipulation tatsächlich erzielten Werten – nicht untermauert werden. Literatur: Klostermann, A. (2014). Finale Fixationen, sportmotorische Leistung und eine Inhibitionshypothese: Mechanismen des „Quiet Eye“, Sportwissenschaft, 44, 49-59. Janelle, C. M., Hillman, C. H., Apparies, R. J., Murray, N. P., Meili, L., Fallon, E. A. & Hatfield, B. D. (2000). Expertise differences in cortical activation and gaze behavior during rifle shooting. Journal of Sport & Exercise Psychology, 22, 167-182.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

isk Management today has moved from being the topic of top level conferences and media discussions to being a permanent issue in the board and top management agenda. Several new directives and regulations in Switzerland, Germany and EU make it obligatory for the firms to have a risk management strategy and transparently disclose the risk management process to their stakeholders. Shareholders, insurance providers, banks, media, analysts, employees, suppliers and other stakeholders expect the board members to be pro-active in knowing the critical risks facing their organization and provide them with a reasonable assurance vis-à-vis the management of those risks. In this environment however, the lack of standards and training opportunities makes this task difficult for board members. This book with the help of real life examples, analysis of drivers, interpretation of the Swiss legal requirements, and information based on international benchmarks tries to reach out to the forward looking leaders of today's businesses. The authors have collectively brought their years of scientific and practical experience in risk management, Swiss law and board memberships together to provide the board members practical solutions in risk management. The desire is that this book will clear the fear regarding risk management from the minds of the company leadership and help them in making risk savvy decisions in quest to achieve their strategic objectives.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this paper, we develop a simple model of the rights a government provides its citizenry. Rights are treated as public goods and taken as primitives in agents utility functions; each agent has preferences over the entire policy vector. We model the interaction among citi-zens and the government as a game in which an exogenous lobbying set makes contributions to the government to in uence policy formu-lation in the matter of rights. When examining contribution schedules comprising truthful Nash strategies, we find that members of the lob-bying set obtain rights closer to their most-preferred bundle, while the rights of non-lobbyers further diverge from their most-preferred bun-dle. Further, if the lobbying set comprises the entire population, the government s allocation of rights does not differ from the allocation achieved in the absence of contributions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Integrated Ocean Drilling Program (IODP) Expedition 302 (Arctic Coring Expedition, ACEX) recovered a unique sediment record from the central Arctic Ocean, revealing that this region underwent major environmental fluctuations since the Late Cretaceous. Major and trace element composition of 1,300 samples were determined using X-ray fluorescence (XRF). The results show significant compositional variability of the sediments with depth that can be attributed to changes in (a) provenance and pathways of detrital material, (b) paleoenvironmental conditions and depositional processes, and (c) diagenetic overprint of the primary record. In addition to existing lithological units, we introduce new geochemical units for a more process-related approach interpreting the ACEX record. In detail, via the geochemical signature of Siberian flood basalts we are able to reconstruct the discontinuous rifting and deepening of the central Lomonosov Ridge during the Paleogene, accompanied by changing current regimes and the onset of sea ice. Eocene biosiliceous sedimentation took place in a relatively shallow setting under predominantly anoxic bottom water conditions, causing a positive anoxia-productivity feedback, although water column stratification was repeatedly interrupted by ventilation events. Anoxic to sulfidic conditions were even more extreme after biosilica production ceased, and significant amounts of pyrite were deposited on the Lomonosov Ridge. Especially in organic matter-rich Paleogene deposits, diagenetic processes obscured the paleoenvironmental signals. Fundamental environmental changes occurred in the Middle Eocene, but geochemical and micropaleontological proxies point not to the identical sediment depth. After approximately 26 Ma of non-deposition or erosion, the Middle Miocene record shows the transition to dominantly oxic bottom water conditions, although suboxic diagenesis seemingly affected these deposits.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Abundances of organic carbon, sulfur, and reactive iron in sediments of three upwelling environments (Peru, Oman and Benguela) suggest that organic carbon/reduced sulfur ratios (C/S-ratios) in this category of marine sediments deviate considerably from previously established empirical ratios in normal marine sediments. To clarify the discrepancies, we investigated those components of the diagenetic system that limit the formation of pyrite: sulfate concentrations and reduction rates in pore waters, availability of reactive iron, and the quantity and quality of organic matter. All three limitations are evident in our sample pools. The results suggest that C/S-ratios in recent and fossil marine sediments rich in organic matter may be unsuitable as paleoenvironmental indicators.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The monograph presents results of deep-sea drilling in the Black Sea carried out in 1975. Detailed lithological, biostratigraphic and geochemical studies of Miocene-Holocene sediments have been carried out by specialists from institutes of the USSR Academy of Sciences, Moscow State University and other organizations. Drilling results are compared with geophysical data. Geological history of the Black Sea basin is considered as well.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Este estudio tuvo por objetivo caracterizar la fertilidad química del suelo superficial nueve meses después de la ocurrencia de fuegos en dos tipos de formaciones del bosque andino patagónico: Nothofagus antarctica y Austrocedrus chilensis. El área de estudio se centró en un sector de suelos de ceniza volcánica que fue afectado por el incendio denominado La Colisión (Chubut, Argentina, febrero 2008) y posteriormente cubierto por ceniza volcánica proveniente del volcán Chaitén (mayo 2008). Se tomaron muestras compuestas de suelo mineral a dos profundidades (0-5 cm y 5-10 cm) en un sector de bosque de N. antarctica y un sector de bosque de A. chilensis, considerando tres niveles de afectación por fuego (control no quemado, poco quemado, muy quemado). En las muestras más superficiales (i.e., 0-5 cm) hubo aumentos significativos de pH y conductividad eléctrica, y disminución de los contenidos de materia orgánica, nitrógeno total, CIC y sodio, como consecuencia del fuego. Las muestras de 5-10 cm evidenciaron disminución de materia orgánica y nitrógeno total y aumento de azufre. El mayor contenido de azufre en los bosques quemados y el aumento observado de fósforo en suelos alofanizados con bajo grado de afectación por fuego, podrían ser beneficiosos para la recuperación de la vegetación.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The sediments of the Argo and Gascoyne abyssal plains are generally lean in organic matter, are immature, and contain hydrocarbons trapped during sediment deposition rather than those generated during sediment catagenesis. TOC concentrations in the Argo Abyssal Plain Cenozoic sediments are 0.5 wt%, and organic matter appears to be from mixed marine and reworked, degraded, organic matter sources, with the latter being contributed by turbidity flows from the nearby continental margin. TOC concentrations within the Cenozoic sediments of the Gascoyne Abyssal Plain are mostly undetectable (<0.1 wt%). Biomarker distributions determined by gas chromatography (GC) and gas chromatography-mass spectrometry (GCMS) indicate that organic matter extracted from the Lower Cretaceous sediments from both sites is predominantly marine with varying contributions from terrestrial organic matter. The specific marine biomarker, 24-n-propylcholestane is in relatively high abundance in all samples. In addition, the relatively high abundance of the 4-methylsteranes with the 23,24-dimethyl side chain (in all samples) indicates significant dinoflagellate contributions and marine organic matter. The ratios of n-C27/n-C17 reflect relative contributions of marine vs. terrestrial organic matter. TOC, while generally low at Argo, is relatively high near the Barremian/Aptian boundary (one sample has a TOC of 5.1 wt%) and the Aptian/Albian boundary (up to 1.3 wt% TOC), and two samples from the Barremian and Aptian sections contain relatively high proportions of terrestrial organic carbon. TOC values in the Lower Cretaceous sediments from Gascoyne Abyssal Plain are low (<0.1 wt%) near the Aptian/Barremian boundary. TOC values are higher in older sediments, with maxima in the upper Barremian (1.02 wt%), the Barremian/Hauterivian (0.6 wt%), and Valanginian (1.8 wt%). Sediments from the upper Barremian contain higher amounts of terrestrial organic carbon than older sediments.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This is part 2 of a study examining southwest African continental margin sediments from nine sites on a north-south transect from the Congo Fan (4°S) to the Cape Basin (30°S) representing two glacial (MIS 2 and 6a) and two interglacial stages (MIS 1 and 5e). Contents, distribution patterns, and molecular stable carbon isotope signatures of long-chain n-alkanes (C27-C33) and n-alkanols (C22-C32) as indicators of land plant vegetation of different biosynthetic types were correlated with concentrations and distributions of pollen taxa in sediments of the same time horizons. Selected single pollen type data reveal details of vegetation changes, but the overall picture is best illustrated by summing pollen known to predominantly derive from C4 plants or C4 plus CAM plants. The C4 plant signals in the biomarkers are recorded in the delta13C data and in the abundances of C31 and C33 n-alkanes, and the C32 n-alkanol. Calculated clusters of wind trajectories for austral summer and winter situations for the Holocene and the Last Glacial Maximum afford information on the source areas for the lipids and pollen and their transport pathways to the ocean. This multidisciplinary approach provides clear evidence of latitudinal differences in leaf wax lipid and pollen composition, with the Holocene sedimentary data paralleling the current major phytogeographic zonations. The northern sites (Congo Fan area and northern Angola Basin) get most of their terrestrial material from the Congo Basin and the Angolan highlands dominated by C3 plants. Airborne particulates derived from the western and central South African hinterland dominated by deserts, semideserts, and savannah regions are rich in organic matter from C4 plants. As can be expected from the present and glacial positions of the phytogeographic zones, the carbon isotopic signatures of n-alkanes and n-alkanols both become isotopically more enriched in 13C from north to south. In the northern part of the transect the relative importance of C4 plant indicators is higher during the glacials than in the interglacials, indicating a northward extension of arid zones favoring grass vegetation. In the south, where grass-rich vegetation merges into semidesert and desert, the difference in C4 plant indicators is small.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Five-hundred ten meters of Cretaceous sediments were drilled north of the Walvis escarpment in Hole 530A during Leg 75. An immature stage of evolution for organic matter can be assigned to all the samples studied. Black shales are interbedded with red and green claystone in the bottom sedimentary unit, Unit 8, which is of Coniacian to late Albian age. The richest organic carbon contents and petroleum potentials occur in the black shales. Detrital organic matter is present throughout the various members of a sequence, mixed with largely oxidized organic matter in the gray and green claystone or marlstone members on both sides. Detrital organic matter also characterizes the black streaks observed in the claystones. Vertical discontinuities in organic matter distribution are assigned to slumping. Several types of black shales can be identified, according to their content of detrital organic matter, the more detrital black levels corresponding to the Albian-Cenomanian period. Cyclic variations of organic matter observed for a sequence can occur for a set of sequences and even for some consecutive sets of sequences. Climatic factors are proposed to account for the cyclic sedimentation and distribution of organic matter for every sequence that includes a black bed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A bulk-sediment and clay-fraction X-ray diffraction study of samples from Deep Sea Drilling Project Leg 60 shows an abundance of the following minerals: plagioclase feldspar, zeolite, smectite, Fe-Mg chlorite, attapulgite, and serpentine. Amorphous compounds are also abundant. The variations in abundance of the different components correspond to episodes of volcanic activity through time. Deposits from periods of great activity are composed of sediments very rich in amorphous matter and in "primary" minerals (e.g., plagioclase feldspars). During relatively quiet periods, clay minerals and zeolites predominate.