1000 resultados para fitzpatrick skin classification
Resumo:
High resolution proton nuclear magnetic resonance spectroscopy (¹H MRS) can be used to detect biochemical changes in vitro caused by distinct pathologies. It can reveal distinct metabolic profiles of brain tumors although the accurate analysis and classification of different spectra remains a challenge. In this study, the pattern recognition method partial least squares discriminant analysis (PLS-DA) was used to classify 11.7 T ¹H MRS spectra of brain tissue extracts from patients with brain tumors into four classes (high-grade neuroglial, low-grade neuroglial, non-neuroglial, and metastasis) and a group of control brain tissue. PLS-DA revealed 9 metabolites as the most important in group differentiation: γ-aminobutyric acid, acetoacetate, alanine, creatine, glutamate/glutamine, glycine, myo-inositol, N-acetylaspartate, and choline compounds. Leave-one-out cross-validation showed that PLS-DA was efficient in group characterization. The metabolic patterns detected can be explained on the basis of previous multimodal studies of tumor metabolism and are consistent with neoplastic cell abnormalities possibly related to high turnover, resistance to apoptosis, osmotic stress and tumor tendency to use alternative energetic pathways such as glycolysis and ketogenesis.
Resumo:
In vivo proton magnetic resonance spectroscopy (¹H-MRS) is a technique capable of assessing biochemical content and pathways in normal and pathological tissue. In the brain, ¹H-MRS complements the information given by magnetic resonance images. The main goal of the present study was to assess the accuracy of ¹H-MRS for the classification of brain tumors in a pilot study comparing results obtained by manual and semi-automatic quantification of metabolites. In vivo single-voxel ¹H-MRS was performed in 24 control subjects and 26 patients with brain neoplasms that included meningiomas, high-grade neuroglial tumors and pilocytic astrocytomas. Seven metabolite groups (lactate, lipids, N-acetyl-aspartate, glutamate and glutamine group, total creatine, total choline, myo-inositol) were evaluated in all spectra by two methods: a manual one consisting of integration of manually defined peak areas, and the advanced method for accurate, robust and efficient spectral fitting (AMARES), a semi-automatic quantification method implemented in the jMRUI software. Statistical methods included discriminant analysis and the leave-one-out cross-validation method. Both manual and semi-automatic analyses detected differences in metabolite content between tumor groups and controls (P < 0.005). The classification accuracy obtained with the manual method was 75% for high-grade neuroglial tumors, 55% for meningiomas and 56% for pilocytic astrocytomas, while for the semi-automatic method it was 78, 70, and 98%, respectively. Both methods classified all control subjects correctly. The study demonstrated that ¹H-MRS accurately differentiated normal from tumoral brain tissue and confirmed the superiority of the semi-automatic quantification method.
Resumo:
Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.
Resumo:
The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.
Resumo:
Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.
Resumo:
In experimental studies, several parameters, such as body weight, body mass index, adiposity index, and dual-energy X-ray absorptiometry, have commonly been used to demonstrate increased adiposity and investigate the mechanisms underlying obesity and sedentary lifestyles. However, these investigations have not classified the degree of adiposity nor defined adiposity categories for rats, such as normal, overweight, and obese. The aim of the study was to characterize the degree of adiposity in rats fed a high-fat diet using cluster analysis and to create adiposity intervals in an experimental model of obesity. Thirty-day-old male Wistar rats were fed a normal (n=41) or a high-fat (n=43) diet for 15 weeks. Obesity was defined based on the adiposity index; and the degree of adiposity was evaluated using cluster analysis. Cluster analysis allowed the rats to be classified into two groups (overweight and obese). The obese group displayed significantly higher total body fat and a higher adiposity index compared with those of the overweight group. No differences in systolic blood pressure or nonesterified fatty acid, glucose, total cholesterol, or triglyceride levels were observed between the obese and overweight groups. The adiposity index of the obese group was positively correlated with final body weight, total body fat, and leptin levels. Despite the classification of sedentary rats into overweight and obese groups, it was not possible to identify differences in the comorbidities between the two groups.
Resumo:
Enzyme technology is an ever-growing field of knowledge and, in recent years, this technology has raised renewed interest, due to the search for new paradigms in several productive processes. Lipases, esterases and cutinases are enzymes used in a wide range of processes involving synthesis and hydrolysis reactions. The objective of this work was to investigate and compare the specific lipase and esterase activities of five enzymes - four already classified as lipases and one classified as cutinase - in the presence of natural and synthetic substrates. All tested enzymes presented both esterase and lipase specific activities. The highest specific esterase activity was observed for Aspergillus 1068 lipase in natural substrate and for F. oxysporum cutinase in synthetic substrate, while the highest specific lipase activity was observed for Geotrichum sp. lipase in natural substrate and for F. oxysporum cutinase in synthetic substrate. These results display some interface-independent lipolytic activity for all lipases tested. This is in accordance with the rationale that a new and broader definition of lipases may be necessary.
Resumo:
Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.
Resumo:
In order to determine the variability of pequi tree (Caryocar brasiliense Camb.) populations, volatile compounds from fruits of eighteen trees representing five populations were extracted by headspace solid-phase microextraction and analyzed by gas chromatography-mass spectrometry. Seventy-seven compounds were identified, including esters, hydrocarbons, terpenoids, ketones, lactones, and alcohols. Several compounds had not been previously reported in the pequi fruit. The amount of total volatile compounds and the individual compound contents varied between plants. The volatile profile enabled the differentiation of all of the eighteen plants, indicating that there is a characteristic profile in terms of their origin. The use of Principal Component Analysis and Cluster Analysis enabled the establishment of markers (dendrolasin, ethyl octanoate, ethyl 2-octenoate and β-cis-ocimene) that discriminated among the pequi trees. According to the Cluster Analysis, the plants were classified into three main clusters, and four other plants showed a tendency to isolation. The results from multivariate analysis did not always group plants from the same population together, indicating that there is greater variability within the populations than between pequi tree populations.
Resumo:
The equilibrium moisture content for adsorption and desorption isotherms of mango skin was determined using the static gravimetric method at temperatures of 20, 26, 33, 38 and 44 oC in the 0.056 to 0.873 water activity range. Both sorption curves show a decrease in equilibrium moisture content as the temperature increasing. The hysteresis effect was observed at constant water activity. The Guggenheim, Anderson, and de Boer (GAB) model presented the best fitting accuracy among a group of models and was used to determine the thermodynamic properties of water sorption. Integral enthalpy and integral entropy areas showed inverted values for the adsorption and desorption isotherms over the wide range of water activity studied. These values confirm, in energetic terms, the difference between adsorption and desorption isotherms observed in the hysteresis phenomenon. Finally, the Gibbs free energy revealed that the sorption process was spontaneous for both sorption isotherms.
Resumo:
-