Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Disparity with respect to a local reference plane as a dominant cue for stereoscopic depth relief

Earlier studies showed that the disparity with respect to other visible points could not explain stereoacuity performance, nor could various spatial derivatives of disparity [Glennerster, A., McKee, S. P., & Birch, M. D. (2002). Evidence of surface-based processing of binocular disparity. Current Biology, 12:825-828; Petrov, Y., & Glennerster, A. (2004). The role of the local reference in stereoscopic detection of depth relief. Vision Research, 44:367-376.] Two possible cues remain: (i) local changes in disparity gradient or (ii) disparity with respect to an interpolated line drawn through the reference points. Here, we aimed to distinguish between these two cues. Subjects judged.. in a two AFC paradigm, whether a target dot was in front of a plane defined by three reference dots or, in other experiments, in front of a line defined by two reference dots. We tested different slants of the reference line or plane and different locations of the target relative to the reference points. For slanted reference lines or plane, stereoacuity changed little as the target position was varied. For judgments relative to a frontoparallel reference line, stereoacuity did vary with target position, but less than would be predicted by disparity gradient change. This provides evidence that disparity with respect to the reference plane is an important cue. We discuss the potential advantages of this measure in generating a representation of surface relief that is invariant to viewpoint transformations. (c) 2006 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Enantiospecific adsorption of alanine on the chiral Cu{531} surface

We have studied enantiospecific differences in the adsorption of (S)- and (R)-alanine on Cu{531}R using low-energy electron diffraction (LEED), X-ray photoelectron spectroscopy, and near edge X-ray absorption fine structure (NEXAFS) spectroscopy. At saturation coverage, alanine adsorbs as alaninate forming a p(1 4) superstructure. LEED shows a significantly higher degree of long-range order for the S than for the R enantiomer. Also carbon K-edge NEXAFS spectra show differences between (S)- and (R)-alanine in the variations of the ð resonance when the linear polarization vector is rotated within the surface plane. This indicates differences in the local adsorption geometries of the molecules, most likely caused by the interaction between the methyl group and the metal surface and/or intermolecular hydrogen bonds. Comparison with model calculations and additional information from LEED and photoelectron spectroscopy suggest that both enantiomers of alaninate adsorb in two different orientations associated with triangular adsorption sites on {110} and {311} microfacets of the Cu{531} surface. The experimental data are ambiguous as to the exact difference between the local geometries of the two enantiomers. In one of two models that fit the data equally well, significantly more (R)-alaninate molecules are adsorbed on {110} sites than on {311} sites whereas for (S)-alaninate the numbers are equal. The enantiospecific differences found in these experiments are much more pronounced than those reported from other ultrahigh vacuum techniques applied to similar systems.

Energy-dependent cancellation of diffraction spots due to surface roughening

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.

Molecular t-matrices for low-energy electron diffraction (TMOL v1.1)*1

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.

Strongly nucleophilic RhI centre in square-planar complexes with terdentate (κ3) 2,2′:6′,2′′-terpyridine ligands: crystallographic, electrochemical and density functional theoretical studies

Rh-I-terpyridine complexes have been unambiguously formed for the first time. The 2,21:6',2"-terpyridine (tpy), 4'-chloro-2,2':6',2"-terpyridine (4'-Cl-tpy) and 4'-(tert-butyldimethylsilyl-ortho-carboranyl)-2,2':6',2"-terpyridine (carboranyl-tpy) ligands were used for successful syntheses and characterisation of the corresponding Rh-I complexes with halide coligands, [Rh(X)(4'-Y-terpyridine)] (X = Cl, Y = H, Cl, carboranyl; X = Br, Y = H). All four neutral Rh-tpy complexes are square planar, with Rh-X bonds in the plane of the 4'-Y-terpyridine ligands. Full characterisation of these dark blue, highly air-sensitive compounds was hampered by their poor solubility in various organic solvents. This is mainly due to the formation of pi-stacked aggregates, as evidenced by the crystal structure of [Rh(Cl)(tpy)]; in addition, [Rh(Cl)(carboranyl-tpy)] merely forms discrete dimers. The (bonding) properties of the novel Rh-I-terpyridine complexes have been studied with single-crystal X-ray diffraction, (time-dependent) density functional theoretical (DFT) calculations, far-infrared spectroscopy, electronic absorption spectroscopy and cyclic voltammetry. From DFT calculations, the HOMO of the studied Rh-I-terpyridine complexes involves predominantly the metal centre, while the LUMO resides on the terpyridine ligand. Absorption bands of the studied complexes in the visible region (400-900 nm) can be assigned to MLCT and MLCT/XLCT transitions. The relatively low oxidation potentials of [Rh(X)(tpy)] (X = Cl, Br) point to a high electron density on the metal centre. This makes the Rh-I-terpyridine complexes strongly nucleophilic and (potentially) highly reactive towards various (small) substrate molecules containing carbon-halide bonds.

Infrared filters for space-flight focal plane array applications

Infrared filters and coatings have been employed on many sensing radiometer instruments to measure the thermal emission profiles and concentrations of certian chemical constituents found in planetary atmospheres. The High Resolution Dynamics Limb Sounder ( HIRDLS) is an example of the most recent developments in limb-viewing radiometry by employing a cooled focal plane detector array to provide simultaneous multi-channel monitoring of emission from gas and aerosols over an altitude range between 8 - 70 km. The use of spectrally selective cooled detectors in focal plane arrays has simplified the optical layout of radiometers, greatly reducing the number of components in the optical train. this has inevitably led to increased demands for the enviromnetal durability of the focal plane filters because of the need to cut sub-millimeter sizes, whilst maintaining an optimal spectral performance. Additionally the remaining refractive optical elements require antireflection coatings which must cover the entire spectral range of the focal plane array channels, in this case 6 to 18µm, with a minimum of reflection and absorption. This paper describes the optical layout and spectral design requirements for filteriong in the HIRDLS instrument, and reports progress on the manufacturing and testing of the sub-millimetre sized cooled filters. We also report on the spectral and environmental performance of prototype wideband antireflection coatings which satisfy the requirements above.

High-performance infrared filters for the HIRDLS 21-channel focal plane detector array

The High Resolution Dynamics Limb Sounder is described, with particular reference to the atmospheric measurements to be made and the rationale behind the measurement strategy. The demands this strategy places on the filters to be used in the instrument and the designs to which this leads to are described. A second set of filters at an intermediate image plane to reduce "Ghost Imaging" is discussed together with their required spectral properties. A method of combining the spectral characteristics of the primary and secondary filters in each channel are combined together with the spectral response of the detectors and other optical elements to obtain the system spectral response weighted appropriately for the Planck function and atmospheric limb absorption. This method is used to demonstrate whether the out-of-band spectral blocking requirement for a channel is being met and an example calculation is demonstrated showing how the blocking is built up for a representative channel. Finally, the techniques used to produce filters of the necessary sub-millimetre sizes together with the testing methods and procedures used to assess the environmental durability and establish space flight quality are discussed.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.