942 resultados para capillary electrochromatography


Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper investigated the influence of the amount of superplasticizer and mineral adding - silica fume and basaltic filer - in plastic shrinkage and cracking of self-compacting concrete (SCC) mortars. Initially analysis was performed of the rheological behavior of cement paste and mortars phases of the compositions of SCC. Then the deformations of mortars were measured by the effect of shrinkage and evaluation of cracking. On plastic shrinkage and cracking, the composition with silica fume showed superior results, independent of wind and superplasticizer content, relative to the composition with addition of basalt filler. However, the composition with silica fume showed superior results only in the tests with imposed ventilation at vertical plastic deformation. The rheological behavior affected directly the plastic shrinkage and cracking at early ages, fact confirmed by the analysis of capillary pressures of mortars tested.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Enfermagem (mestrado profissional) - FMB

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The deslignification with oxygen, also denominated pre-O2, consists in a whitening stage, which consists of accomplishing an oxidation of the lignin, and remove it with the alkali, providing a larger earnings in the bleaching of the pulp. The pre-O2 is a process already very established, where a significant part of the cellulose of whitened short fiber produced nowadays suffers deslignification for this method. The conditions of work of this stage contemplate directly in the results of the deslignification level, in the physical, optical and mechanics properties of the pulp, and consequently of the paper, because this is important to know their effects fully. The main variables related to the control of this process are respectively: pressure and oxygen load, alkaline load, consistence, time and temperature, being this last variable was the study focus in this work. The objective of the work was to analyze the effect of the variation of the temperature in the oxygen whitening along every bleaching process of the pulp, refine and in the optical, physics and mechanics properties of the paper. The development of the work was based in four temperature levels (90, 95, 100 and 105°C) combined to two whitening sequences (OD0(E+P)D1P and OAHTD0(E+P)D1P). The results obtained in the oxygen deslignification stage indicated that the elevation of the temperature contemplated in increases of the whiteness, deslignification efficiency and in the viscosity loss allied to the reduction of the selectivity of the process. In the remaining of the whitening, the sequence that included the acid hydrolysis presented values slightly inferior of whiteness, kappa number, viscosity and yield in relation to the other sequence when compared with the samples of same temperatures. Already the physical tests showed that the sequence with acid stage amplifies the values of capillary... (Complete abstract click electronic access below)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Septic shock remains one of the most common challenges for the small animal practicing, presenting high mortality rates frequently associated with late identification of this syndrome, as well as an inappropriate treatment. In general, disruption of homeostasis occurs with an intense activation of inflammatory cascade, which leads to a damage to endothelial cells and an exposure to these cytokines, which will result in vasodilation and increased capillary permeability. Thus, there is a drop in blood pressure, even after aggressive fluid resuscitation. Therefore, drugs such as vasopressors, which act by increasing systemic vascular resistance, and inotropes, which have an effect on heart pump, should be administered in order to raise blood pressure, ensuring adequate tissue perfusion. The objective of this review was to gather information about the various drugs used in vasopressors/inotropes therapy, trying to explain the role of each one in different situations, in order to increase the survival rate in dogs affected with septic shock

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Televisão Digital: Informação e Conhecimento - FAAC

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Engenharia Mecânica - FEG

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)