Effects of dietary lipids on renal function of aged rats

Normal aging is accompanied by renal functional and morphological deterioration and dietetic manipulation has been used to delay this age-related decline. We examined the effects of chronic administration of diets containing 5% lipid-enriched diet (LD, w/w) on renal function of rats at different ages. Three types of LD were tested: canola oil, fish oil and butter. Mean systemic tail-cuff blood pressure and glycemia remained within the normal range whatever the age and the diet of the animals. Proteinuria began to rise from the 8th month in the groups ingesting LD, while in the control group it increased significantly (above 10 mg/24 h) only after the 10th month. With age, a significant and progressive decline in glomerular filtration rate (GFR) and renal plasma flow was observed in the LD groups but after 6 months of lipid supplementation, the decline in these parameters was more marked in the butter and fish oil groups. By the 18th month, the lowest GFR level was observed in the group ingesting the butter diet (2.93 ± 0.22 vs 5.01 ± 0.21 ml min-1 kg-1 in control, P<0.05). Net acid excretion, evaluated in 9- and 18-month-old rats, was stimulated in the fish oil group when compared both to control and to the other two LD groups. These results suggest that even low levels of LD in a chronic nutritional regimen can modify the age-related changes in renal function and that the impact of different types of lipid-supplemented diets on renal function depends on the kind of lipid present in the diet.

Insights into the physiological function of cellular prion protein

Prions have been extensively studied since they represent a new class of infectious agents in which a protein, PrPsc (prion scrapie), appears to be the sole component of the infectious particle. They are responsible for transmissible spongiform encephalopathies, which affect both humans and animals. The mechanism of disease propagation is well understood and involves the interaction of PrPsc with its cellular isoform (PrPc) and subsequently abnormal structural conversion of the latter. PrPc is a glycoprotein anchored on the cell surface by a glycosylphosphatidylinositol moiety and expressed in most cell types but mainly in neurons. Prion diseases have been associated with the accumulation of the abnormally folded protein and its neurotoxic effects; however, it is not known if PrPc loss of function is an important component. New efforts are addressing this question and trying to characterize the physiological function of PrPc. At least four different mouse strains in which the PrP gene was ablated were generated and the results regarding their phenotype are controversial. Localization of PrPc on the cell membrane makes it a potential candidate for a ligand uptake, cell adhesion and recognition molecule or a membrane signaling molecule. Recent data have shown a potential role for PrPc in the metabolism of copper and moreover that this metal stimulates PrPc endocytosis. Our group has recently demonstrated that PrPc is a high affinity laminin ligand and that this interaction mediates neuronal cell adhesion and neurite extension and maintenance. Moreover, PrPc-caveolin-1 dependent coupling seems to trigger the tyrosine kinase Fyn activation. These data provide the first evidence for PrPc involvement in signal transduction.

Effect of chronic fish oil supplementation on renal function of normal and cachectic rats

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Social disability of Brazilian mood disorder patients

Mood disorders cause many social problems, often involving family relationships. Few studies are available in the literature comparing patients with bipolar, unipolar, dysthymic, and double depressive disorders concerning these aspects. In the present study, demographic and disease data were collected using a specifically prepared questionnaire. Social adjustment was assessed using the Disability Adjustment Scale and family relationships were evaluated using the Global Assessment of Relational Functioning Scale. One hundred patients under treatment for at least 6 months were evaluated at the Psychiatric Outpatient Clinic of the Botucatu School of Medicine, UNESP. Most patients were women (82%) more than 50 (49%) years old with at least two years of follow-up, with little schooling (62% had less than 4 years), and of low socioeconomic level. Logistic regression analysis showed that a diagnosis of unipolar disorder (P = 0.003, OR = 0.075, CI = 0.014-0.403) and dysthymia (P = 0.001, OR = 0.040, CI = 0.006-0.275) as well as family relationships (P = 0.002, OR = 0.953, CI = 0914-0.992) played a significant role in social adjustment. Unipolar and dysthymic patients presented better social adjustment than bipolar and double depressive patients (P < 0.001), results that were not due to social class. These patients, treated at a teaching hospital, may represent the severest mood disorder cases. Evaluations were made knowing the diagnosis of the patients, which might also have influenced some of the results. Social disabilities among mood disorder patients are very frequent and intensive.

Acetylcholine and bradykinin enhance hypotension and affect the function of remodeled conduit arteries in SHR and SHR treated with nitric oxide donors

Discrepancy was found between enhanced hypotension and attenuated relaxation of conduit arteries in response to acetylcholine (ACh) and bradykinin (BK) in nitric oxide (NO)-deficient hypertension. The question is whether a similar phenomenon occurs in spontaneously hypertensive rats (SHR) with a different pathogenesis. Wistar rats, SHR, and SHR treated with NO donors [molsidomine (50 mg/kg) or pentaerythritol tetranitrate (100 mg/kg), twice a day, by gavage] were studied. After 6 weeks of treatment systolic blood pressure (BP) was increased significantly in experimental groups. Under anesthesia, the carotid artery was cannulated for BP recording and the jugular vein for drug administration. The iliac artery was used for in vitro studies and determination of geometry. Compared to control, SHR showed a significantly enhanced (P < 0.01) hypotensive response to ACh (1 and 10 µg, 87.9 ± 6.9 and 108.1 ± 5.1 vs 35.9 ± 4.7 and 64.0 ± 3.3 mmHg), and BK (100 µg, 106.7 ± 8.3 vs 53.3 ± 5.2 mmHg). SHR receiving NO donors yielded similar results. In contrast, maximum relaxation of the iliac artery in response to ACh was attenuated in SHR (12.1 ± 3.6 vs 74.2 ± 8.6% in controls, P < 0.01). Iliac artery inner diameter also increased (680 ± 46 vs 828 ± 28 µm in controls, P < 0.01). Wall thickness, wall cross-section area, wall thickness/inner diameter ratio increased significantly (P < 0.01). No differences were found in this respect among SHR and SHR treated with NO donors. These findings demonstrated enhanced hypotension and attenuated relaxation of the conduit artery in response to NO activators in SHR and in SHR treated with NO donors, a response similar to that found in NO-deficient hypertension.

Impact of initial exposure to calcineurin inhibitors on kidney graft function of patients at high risk to develop delayed graft function

We conducted a retrospective analysis of the influence of full doses of calcineurin inhibitors [8-10 mg kg-1 day-1 cyclosporine (N = 80), or 0.2-0.3 mg kg-1 day-1 tacrolimus (N = 68)] administered from day 1 after transplantation on the transplant outcomes of a high-risk population. Induction therapy was used in 13% of the patients. Patients also received azathioprine (2 mg kg-1 day-1, N = 58) or mycophenolate mofetil (2 g/day, N = 90), and prednisone (0.5 mg kg-1 day-1, N = 148). Mean time on dialysis was 79 ± 41 months, 12% of the cases were re-transplants, and 21% had panel reactive antibodies >10%. In 43% of donors the cause of death was cerebrovascular disease and 27% showed creatinine above 1.5 mg/dL. The incidence of slow graft function (SGF) and delayed graft function (DGF) was 15 and 60%, respectively. Mean time to last dialysis and to nadir creatinine were 18 ± 15 and 34 ± 20 days, respectively. Mean creatinine at 1 year after transplantation was 1.48 ± 0.50 mg/dL (DGF 1.68 ± 0.65 vs SGF 1.67 ± 0.66 vs immediate graft function (IGF) 1.41 ± 0.40 mg/dL, P = 0.089). The incidence of biopsy-confirmed acute rejection was 22% (DGF 31%, SGF 10%, IGF 8%). One-year patient and graft survival was 92.6 and 78.4%, respectively. The incidence of cytomegalovirus disease, post-transplant diabetes mellitus and malignancies was 28, 8.1, and 0%, respectively. Compared to previous studies, the use of initial full doses of calcineurin inhibitors without antibody induction in patients with SGF or DGF had no negative impact on patient and graft survival.

Indoor NO2 air pollution and lung function of professional cooks

Studies of cooking-generated NO2 effects are rare in occupational epidemiology. In the present study, we evaluated the lung function of professional cooks exposed to NO2 in hospital kitchens. We performed spirometry in 37 cooks working in four hospital kitchens and estimated the predicted FVC, FEV1 and FEF25-75, based on age, sex, race, weight, and height, according to Knudson standards. NO2 measurements were obtained for 4 consecutive days during 4 different periods at 20-day intervals in each kitchen. Measurements were performed inside and outside the kitchens, simultaneously using Palm diffusion tubes. A time/exposure indicator was defined as representative of the cumulative exposure of each cook. No statistically significant effect of NO2 exposure on FVC was found. Each year of work as a cook corresponded to a decrease in predicted FEV1 of 2.5% (P = 0.046) for the group as a whole. When smoking status and asthma were included in the analysis the effect of time/exposure decreased about 10% and lost statistical significance. On predicted FEF25-75, a decrease of 3.5% (P = 0.035) was observed for the same group and the inclusion of controllers for smoking status and asthma did not affect the effects of time/exposure on pulmonary function parameter. After a 10-year period of work as cooks the participants of the study may present decreases in both predicted FEV1 and FEF25-75 that can reach 20 and 30%, respectively. The present study showed small but statistically significant adverse effects of gas stove exposure on the lung function of professional cooks.

Effect of metabolic syndrome and of its individual components on renal function of patients with type 2 diabetes mellitus

The objective of this study was to evaluate the effect of metabolic syndrome (MetS) and its individual components on the renal function of patients with type 2 diabetes mellitus (DM). A cross-sectional study was performed in 842 type 2 DM patients. A clinical and laboratory evaluation, including estimated glomerular filtration rate (eGFR) calculated by the modification of diet in renal disease formula, was performed. MetS was defined according to National Cholesterol Education Program - Adult Treatment Panel III criteria. Mean patient age was 57.9 ± 10.1 years and 313 (37.2%) patients were males. MetS was detected in 662 (78.6%) patients. A progressive reduction in eGFR was observed as the number of individual MetS components increased (one: 98.2 ± 30.8; two: 92.9 ± 28.1; three: 84.0 ± 25.1; four: 83.8 ± 28.5, and five: 79.0 ± 23.0; P < 0.001). MetS increased the risk for low eGFR (<60 mL·min-1·1.73 (m²)-1) 2.82-fold (95%CI = 1.55-5.12, P < 0.001). Hypertension (OR = 2.2, 95%CI = 1.39-3.49, P = 0.001) and hypertriglyceridemia (OR = 1.62, 95%CI = 1.19-2.20, P = 0.002) were the individual components with the strongest associations with low eGFR. In conclusion, there is an association between MetS and the reduction of eGFR in patients with type 2 DM, with hypertension and hypertriglyceridemia being the most important contributors in this sample. Interventional studies should be conducted to determine if treatment of MetS can prevent renal failure in type 2 DM patients.

The effect of microgravity on tissue structure and function of rat testis

To explore whether an environment of weightlessness will cause damage to the reproductive system of animals, we used the tail-suspension model to simulate microgravity, and investigated the effect of microgravity on the tissue structure and function of the testis in sexually mature male rats. Forty-eight male Wistar rats weighing 200-250 g were randomly assigned to three groups (N = 16 each): control, tail traction, and tail suspension. After the rats were suspended for 7 or 14 days, morphological changes of testis were evaluated by histological and electron microscopic methods. The expression of HSP70, bax/bcl-2 and AR (androgen receptor) in testis was measured by immunohistochemistry. Obvious pathological lesions were present in the testis after the rats were suspended for 7 or 14 days. We detected overexpression of HSP70 and an increase of apoptotic cells, which may have contributed to the injury to the testis. The expression of AR, as an effector molecule in the testis, was significantly decreased in the suspended groups compared to control (P < 0.01). We also observed that, with a longer time of suspension, the aforementioned pathological damage became more serious and some pathological injury to the testis was irreversible. The results demonstrated that a short- or medium-term microgravity environment could lead to severe irreversible damage to the structure of rat testis.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Effect of hyperbaric oxygenation on mitochondrial function of neuronal cells in the cortex of neonatal rats after hypoxic-ischemic brain damage

The timing and mechanisms of protection by hyperbaric oxygenation (HBO) in hypoxic-ischemic brain damage (HIBD) have only been partially elucidated. We monitored the effect of HBO on the mitochondrial function of neuronal cells in the cerebral cortex of neonatal rats after HIBD. Neonatal Sprague-Dawley rats (total of 360 of both genders) were randomly divided into normal control, HIBD, and HIBD+HBO groups. The HBO treatment began immediately after hypoxia-ischemia (HI) and continued once a day for 7 consecutive days. Animals were euthanized 0, 2, 4, 6, and 12 h post-HI to monitor the changes in mitochondrial membrane potential (ΔΨm) occurring soon after a single dose of HBO treatment, as well as 2, 3, 4, 5, 6, and 7 days post-HI to study ΔΨm changes after a series of HBO treatments. Fluctuations in ΔΨm were observed in the ipsilateral cortex in both HIBD and HIBD+HBO groups. Within 2 to 12 h after HI insult, the ΔΨm of the HIBD and HIBD+HBO groups recovered to some extent. A secondary drop in ΔΨm was observed in both groups during the 1-4 days post-HI period, but was more severe in the HIBD+HBO group. There was a secondary recovery of ΔΨm observed in the HIBD+HBO group, but not in the HIBD group, during the 5-7 days period after HI insult. HBO therapy may not lead to improvement of neural cell mitochondrial function in the cerebral cortex in the early stage post-HI, but may improve it in the sub-acute stage post-HI.