986 resultados para Polymer-solutions
Resumo:
A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
The self-consistent field theory (SCFT) prediction for the compression force between two semi-dilute polymer brushes is compared to the benchmark experiments of Taunton et al. [Nature, 1988, 332, 712]. The comparison is done with previously established parameters, and without any fitting parameters whatsoever. The SCFT provides a significant quantitative improvement over the classical strong-stretching theory (SST), yielding excellent quantitative agreement with the experiment. Contrary to earlier suggestions, chain fluctuations cannot be ignored for normal experimental conditions. Although the analytical expressions of SST provide invaluable aids to understanding the qualitative behavior of polymeric brushes, the numerical SCFT is necessary in order to provide quantitatively accurate predictions.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
An elastomeric, healable, supramolecular polymer blend comprising a chain-folding polyimide and a telechelic polyurethane with pyrenyl end groups is compatibilized by aromatic pi-pi stacking between the pi-electron-deficient diimide groups and the pi-electron-rich pyrenyl units. This interpolymer interaction is the key to forming a tough, healable, elastomeric material. Variable-temperature FTIR analysis of the bulk material also conclusively demonstrates the presence of hydrogen bonding, which complements the pi-pi stacking interactions. Variable-temperature SAXS analysis shows that the healable polymeric blend has a nanophase-separated morphology and that the X-ray contrast between the two types of domain increases with increasing temperature, a feature that is repeatable over several heating and cooling cycles. A fractured sample of this material reproducibly regains more than 95% of the tensile modulus, 91% of the elongation to break, and 77% of the modulus of toughness of the pristine material.
Resumo:
The motion in concentrated polymer systems is described by either the Rouse or the reptation model, which both assume that the relaxation of each polymer chain is independent of the surrounding chains. This, however, is in contradiction with several experiments. In this Letter, we propose a universal description of orientation coupling in polymer melts in terms of the time-dependent coupling parameter κ(t). We use molecular dynamics simulations to show that the coupling parameter increases with time, reaching about 50% at long times, independently of the chain length or blend composition. This leads to predictions of component dynamics in mixtures of different molecular weights from the knowledge of monodisperse dynamics for unentangled melts. Finally, we demonstrate that entanglements do not play a significant role in the observed coupling. © 2010 The American Physical Society
Resumo:
This paper addresses the statistical mechanics of ideal polymer chains next to a hard wall. The principal quantity of interest, from which all monomer densities can be calculated, is the partition function, G N(z) , for a chain of N discrete monomers with one end fixed a distance z from the wall. It is well accepted that in the limit of infinite N , G N(z) satisfies the diffusion equation with the Dirichlet boundary condition, G N(0) = 0 , unless the wall possesses a sufficient attraction, in which case the Robin boundary condition, G N(0) = - x G N ′(0) , applies with a positive coefficient, x . Here we investigate the leading N -1/2 correction, D G N(z) . Prior to the adsorption threshold, D G N(z) is found to involve two distinct parts: a Gaussian correction (for z <~Unknown control sequence '\lesssim' aN 1/2 with a model-dependent amplitude, A , and a proximal-layer correction (for z <~Unknown control sequence '\lesssim' a described by a model-dependent function, B(z).
Resumo:
This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.
Resumo:
The hierarchical and "bob" (or branch-on-branch) models are tube-based computational models recently developed for predicting the linear rheology of general mixtures of polydisperse branched polymers. These two models are based on a similar tube-theory framework but differ in their numerical implementation and details of relaxation mechanisms. We present a detailed overview of the similarities and differences of these models and examine the effects of these differences on the predictions of the linear viscoelastic properties of a set of representative branched polymer samples in order to give a general picture of the performance of these models. Our analysis confirms that the hierarchical and bob models quantitatively predict the linear rheology of a wide range of branched polymer melts but also indicate that there is still no unique solution to cover all types of branched polymers without case-by-case adjustment of parameters such as the dilution exponent alpha and the factor p(2) which defines the hopping distance of a branch point relative to the tube diameter. An updated version of the hierarchical model, which shows improved computational efficiency and refined relaxation mechanisms, is introduced and used in these analyses.
Resumo:
We performed atomistic molecular dynamics simulations of anionic and cationic micelles in the presence of poly(ethylene oxide) (PEO) to understand why nonionic water-soluble polymers such as PEO interact strongly with anionic micelles but only weakly with cationic micelles. Our micelles include sodium n-dodecyl sulfate (SDS), n-dodecyl trimethylammonium chloride (DTAC), n-dodecyl ammonium chloride (DAC), and micelles in which we artificially reverse the sign of partial charges in SDS and DTAC. We observe that the polymer interacts hydrophobically with anionic SDS but only weakly with cationic DTAC and DAC, in agreement with experiment. However, the polymer also interacts with the artificial anionic DTAC but fails to interact hydrophobically with the artificial cationic SDS, illustrating that large headgroup size does not explain the weak polymer interaction with cationic micelles. In addition, we observe through simulation that this preference for interaction with anionic micelles still exists in a dipolar "dumbbell" solvent, indicating that water structure and hydrogen bonding alone cannot explain this preferential interaction. Our simulations suggest that direct electrostatic interactions between the micelle and polymer explain the preference for interaction with anionic micelles, even though the polymer overall carries no net charge. This is possible given the asymmetric distribution of negative charges on smaller atoms and positive charges oil larger units in the polymer chain.
Resumo:
We have performed atomistic molecular dynamics simulations of an anionic sodium dodecyl sulfate (SDS) micelle and a nonionic poly(ethylene oxide) (PEO) polymer in aqueous solution. The micelle consisted of 60 surfactant molecules, and the polymer chain lengths varied from 20 to 40 monomers. The force field parameters for PEO were adjusted by using 1,2-dimethoxymethane (DME) as a model compound and matching its hydration enthalpy and conformational behavior to experiment. Excellent agreement with previous experimental and simulation work was obtained through these modifications. The simulated scaling behavior of the PEO radius of gyration was also in close agreement with experimental results. The SDS-PEO simulations show that the polymer resides on the micelle surface and at the hydrocarbon-water interface, leading to a selective reduction in the hydrophobic contribution to the solvent-accessible surface area of the micelle. The association is mainly driven by hydrophobic interactions between the polymer and surfactant tails, while the interaction between the polymer and sulfate headgroups on the micelle surface is weak. The 40-monomer chain is mostly wrapped around the micelle, and nearly 90% of the monomers are adsorbed at low PEO concentration. Simulations were also performed with multiple 20-monomer chains, and gradual addition of polymer indicates that about 120 monomers are required to saturate the micelle surface. The stoichiometry of the resulting complex is in close agreement with experimental results, and the commonly accepted "beaded necklace" structure of the SDS-PEO complex is recovered by our simulations.
Resumo:
This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.
Resumo:
Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.
Resumo:
We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.