A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis

BACKGROUND A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. RESULTS Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp. and Taylorella spp. High-throughput sequencing reads from the Illumina-Solexa platform were assembled with the Edena de novo assembler to form 195 contigs comprising the ~2 Mb genome. Genome annotation with RAST, construction of phylogenetic trees with the 16S rDNA (rrs) gene sequence and the rpoB gene, and phylogenetic placement using other highly conserved marker genes with ML Tree all suggest that the bacterial species belongs to the Alcaligenaceae family. Analysis of samples from cages with healthy parakeets suggested that the newly discovered bacterial species is not widespread in parakeet living quarters. CONCLUSIONS Classification of this organism in the current taxonomy system requires the formation of a new genus and species. We designate the new genus Basilea and the new species psittacipulmonis. The type strain of Basilea psittacipulmonis is DSM 24701 (= CIP 110308 T, 16S rDNA gene sequence Genbank accession number JX412111 and GI 406042063).

The splenic autoimmune response to ADAMTS13 in thrombotic thrombocytopenic purpura contains recurrent antigen-binding CDR3 motifs.

Acquired thrombotic thrombocytopenic purpura (TTP) is the consequence of a severe ADAMTS13 deficiency resulting from autoantibodies inhibiting ADAMTS13 or accelerating its clearance. Despite the success of plasma exchange the risk of relapse is high. From 2 patients (A and B), splenectomized for recurrent episodes of acquired TTP, the splenic B-cell response against ADAMTS13 was characterized through generation of human monoclonal anti-ADAMTS13 autoantibodies (mAbs) by cloning an immunoglobulin G (IgG)4κ- and IgG4λ-Fab library using phage display technology and by Epstein-Barr virus transformation of switched memory B cells (CD19+/CD27+/IgG+). Sequence analysis of the anti-ADAMTS13 IgGs of both patients revealed that the VH gene use was limited in our patients to VH1-3 (55%), VH1-69 (17%), VH3-30 (7%), and VH4-28 (21%) and contained 8 unique and thus far not reported heavy-chain complementarity determining region 3 motifs, of which 4 were shared by the 2 patients. The discovery of several highly similar anti-ADAMTS13 autoantibodies in 2 unrelated TTP patients suggests that the autoimmune response is antigen driven, because the probability that such similar immunoglobulin rearrangements happen by chance is very low (< 10(-9)).

Natural anti-FcepsilonRIalpha autoantibodies may interfere with diagnostic tests for autoimmune urticaria.

IgG autoantibodies against the alpha-chain of the high affinity IgE receptor are claimed to play a pathogenetic role in autoimmune urticaria. The best methods for detection of functional autoantibodies are currently the autologous serum skin test and the basophil histamine release assay. A simplified and feasible screening test would facilitate the diagnosis of autoimmune urticaria. Here we offer an explanation for the difficulties in establishing a screening test for autoantibodies directed against the alpha-chain of the high affinity IgE receptor in autoimmune urticaria. Identical autoantibodies in chronic urticaria patients and healthy donors belonging to the natural autoantibody repertoire were found by sequence analysis of anti-alpha-chain autoantibodies isolated by repertoire cloning from antibody libraries. These natural autoantibodies bound to the receptor and triggered histamine release but only if IgE was previously removed from the receptor. Diagnostic assays used for detection of antibodies directed against the IgE receptor may require signal comparison with and without the artificial removal of IgE, immune complexes, and complement in order to avoid false positive or negative results. After IgE removal diagnostic tests will detect natural autoantibodies against the high affinity IgE receptor regardless of whether they are pathogenic or not.

Molecular characterization and SNP development for the porcine IL6 and IL10 genes

Different cytokines are secreted in response to specific microbial molecules referred to as pathogen associated molecular patterns (PAMPs). Interleukin 6 (IL6) and interleukin 10 (IL10), both secreted by macrophages and lymphocytes, play a central role in the immunological response. In this work we obtained the genomic structure and complete DNA sequence of the porcine IL6 and IL10 genes and identified polymorphisms in the genomic sequences of these genes on a panel of ten different pig breeds. Comparative intra- and interbreed sequence analysis revealed a total of eight polymorphisms in the porcine IL6 gene and 21 in the porcine IL10 gene, which include single nucleotide polymorphisms (SNPs) and insertion deletion polymorphisms (indels). Additionally, the chromosomal localization of the IL10 gene was determined by FISH and RH mapping.

A 1.8-kb insertion in the 3'-UTR of RXFP2 is associated with polledness in sheep

Sheep breeds show a broad spectrum of different horn phenotypes. In most modern production breeds, sheep are polled (absence of horns), whereas horns occur mainly in indigenous breeds. Previous studies mapped the responsible locus to the region of the RXFP2 gene on ovine chromosome 10. A 4-kb region of the 3'-end of RXFP2 was amplified in horned and polled animals from seven Swiss sheep breeds. Sequence analysis identified a 1833-bp genomic insertion located in the 3'-UTR region of RXFP2 present in polled animals only. An efficient PCR-based genotyping method to determine the polled genotype of individual sheep is presented. Comparative sequence analyses revealed evidence that the polled-associated insertion adds a potential antisense RNA sequence of EEF1A1 to the 3'-end of RXFP2 transcripts.

The gene for histone RNA hairpin binding protein is located on human chromosome 4 and encodes a novel type of RNA binding protein.

The hairpin structure at the 3' end of animal histone mRNAs controls histone RNA 3' processing, nucleocytoplasmic transport, translation and stability of histone mRNA. Functionally overlapping, if not identical, proteins binding to the histone RNA hairpin have been identified in nuclear and polysomal extracts. Our own results indicated that these hairpin binding proteins (HBPs) bind their target RNA as monomers and that the resulting ribonucleoprotein complexes are extremely stable. These features prompted us to select for HBP-encoding human cDNAs by RNA-mediated three-hybrid selection in Saccharomyces cerevesiae. Whole cell extract from one selected clone contained a Gal4 fusion protein that interacted with histone hairpin RNA in a sequence- and structure-specific manner similar to a fraction enriched for bovine HBP, indicating that the cDNA encoded HBP. DNA sequence analysis revealed that the coding sequence did not contain any known RNA binding motifs. The HBP gene is composed of eight exons covering 19.5 kb on the short arm of chromosome 4. Translation of the HBP open reading frame in vitro produced a 43 kDa protein with RNA binding specificity identical to murine or bovine HBP. In addition, recombinant HBP expressed in S. cerevisiae was functional in histone pre-mRNA processing, confirming that we have indeed identified the human HBP gene.

Conserved sequences and cell-specific DNase I hypersensitive sites upstream from the co-ordinately expressed alpha I- and alpha II-globin genes of Xenopus laevis

The globin gene family of Xenopus laevis comprises pairs of closely related genes that are arranged in two clusters, each pair of genes being co-ordinately and stage-specifically expressed. To get information on putative regulatory elements, we compared the DNA sequences and the chromatin conformation 5' to the co-ordinately expressed adult alpha-globin genes. Sequence analysis revealed a relatively conserved region from the cap site up to position -289, and further upstream seven distinct boxes of homology, separated by more diverged sequences or deletions/insertions. The homology boxes comprise 22 to 194 base-pairs showing 78 to 95% homology. Analysis of chromatin conformation showed that DNase I preferentially cuts the upstream region of both genes at similar positions, 5' to the T-A-T-A and the C-C-A-A-T boxes, only in chromatin of adult erythroblasts and erythrocytes, where adult globin genes are expressed, but not in chromatin of adult liver cells or larval erythrocytes, where these genes are silent. This suggests that cell- and stage-specific activation of these genes coincides with specific changes in chromatin conformation within the proximal upstream region. No difference was found in the nucleotide sequence within the DNase I hypersensitive region proximal to the adult alpha 1-globin gene in DNA from embryonic cells, in which this gene is inactive, and adult erythrocytes, expressing this gene.

The emergence of epitheliocystis in the upper Rhone region: evidence for Chlamydiae in wild and farm salmonid populations

We present the first study comparing epitheliocystis in a wild and farmed salmonid in Europe. Sampling three tributaries to the Lake Geneva, including one from headwaters to river mouth, revealed an unequal distribution of epitheliocystis in brown trout (Salmo trutta). When evaluated histologically and comparing sites grouped as wild versus farm, the probability of finding infected trout is higher on farms. In contrast, the infection intensities, as estimated by the number of cysts per gill arch, were higher on average and showed maximum values in the wild trout. Sequence analysis showed the most common epitheliocystis agents were Candidatus Piscichlamydia salmonis, all clustering into a single clade, whereas Candidatus Clavichlamydia salmonicola sequences cluster in two closely related sub-species, of which one was mostly found in farmed fish and the other exclusively in wild brown trout, indicating that farms are unlikely to be the source of infections in wild trout. A detailed morphological analysis of cysts using transmission electron microscopy revealed unique features illustrating the wide divergence existing between Ca. P. salmonis and Ca. C. salmonicola within the phylum Chlamydiae

Geographic distribution and molecular diversity of Bartonella infections in moose, Alces alces, in Finland.

Moose, Alces alces (Artiodactyla: Cervidae) in Finland are heavily infested with deer keds, Lipoptena cervi (Diptera: Hippoboschidae). The deer ked, which carries species of the genus Bartonella, has been proposed as a vector for the transmission of bartonellae to animals and humans. Previously, bartonella DNA was found in deer keds as well as in moose blood collected in Finland. We investigated the prevalence and molecular diversity of Bartonella spp. infection from blood samples collected from free-ranging moose. Given that the deer ked is not present in northernmost Finland, we also investigated whether there were geographic differences in the prevalence of bartonella infection in moose. The overall prevalence of bartonella infection was 72.9% (108/148). Geographically, the prevalence was highest in the south (90.6%) and lowest in the north (55.9%). At least two species of bartonellae were identified by multilocus sequence analysis. Based on logistic regression analysis, there was no significant association between bartonella infection and either age or sex; however, moose from outside the deer ked zone were significantly less likely to be infected (P<0.015) than were moose hunted within the deer ked zone.

Isolation and Characterization of a Microorganism from Groundwater that Reduces Arsenate

This is an investigation into the microbially mediated processes involved in the transformation of arsenic. With the recent change in the Federal Maximum Contaminant Level for arsenic in drinking water, an increasing amount of resources are being devoted to understanding the mechanisms involved in the movement of arsenic. Arsenic in drinking water typically comes from natural sources, but the triggers that result in increased release of arsenic from parent material are poorly understood. Knowledge of these processes is necessary in order to make sound engineering decisions regarding drinking water management practices. Recent years have brought forth the idea that bacteria play a significant role in arsenic cycling. Groundwater is a major source of potable water in this and many other countries. To date, no reports have been made indicating the presence and activity of arsenate reducing bacteria in groundwater settings, which may increase dissolved arsenic concentrations. This research was designed to address this question and has shown that these bacteria are present in Maine groundwater. Two Maine wells were sampled in order to culture resident bacteria that are capable of dissimilatory arsenate reduction. Samples were collected using anaerobic techniques fiom wells in Northport and Green Lake. These samples were amended with specific compounds to enrich the resident population of arsenate utilizing bacteria. These cultures were monitored over time to establish rates of arsenate reduction. Cultures fiom both sites exhibited arsenate reduction in initial enrichment cultures. Isolates obtained fiom the Green Lake enrichments, however, did not reduce arsenate. This indicates either that a symbiotic relationship was required for the observed arsenate reduction or that fast-growing fermentative organisms that could survive in high arsenate media were picked in the isolation procedure. The Northport cultures exhibited continued arsenate reduction after isolation and successive transfers into fiesh media. The cultured bacteria reduced the majority of 1 a arsenate solutions in less than one week, accompanied by a corresponding oxidation of lactate. The 16s rRNA fiom the isolate was arnplifled and sequenced. The results of the DNA sequence analysis indicate that the rRNA sequence of the bacteria isolated at the Northport site is unique. This means that this strain of bacteria has not been reported before. It is in the same taxonomic subgroup as two previously described arsenate respirers. The implications of this study are significant. The fact that resident bacteria are capable of reducing arsenate has implications for water management practices. Reduction of arsenate to arsenite increases the mobility of the compound, as well as the toxicity. An understanding of the activity of these types of organisms is necessary in order to understand the contribution they are making to arsenic concentrations in drinking water. The next step in this work would be to quantitj the actual loading of dissolved arsenic present in aquifers because of these organisms.

Identification and characterization of virulence factors in Enterococcus faecalis

Enterococci are one of the leading causes of nosocomial infections, and Enterococcus faecalis causes the majority of enterococcal infections. However, the mechanisms of enterococcal pathogenesis are still not yet understood. In our initial screening of E. faecalis strain OG1RF genomic libraries, autolysin and a homolog of a protein of Enterococcus faecium previously designated P54 were found to be two major antigens that reacted with human patient sera, and an antigen designated MH-1 antigen that reacted with serum from a endocarditis patient was also identified. To explore a possible role for these antigens in enterococcal infections, the genes encoding these three antigens were disrupted in Enterococcus faecalis OG1RF. ^ To explore a possible role of an E. faecalis gelatinase (encoded by gelE), which belongs to a family of Zn-metalloproteases that have been shown to be virulence factors in other organisms, in enterococcal infections, an insertion mutant was constructed in OG1RF and tested in the mouse peritonitis model. The mice infected with the gelE mutant showed a significantly prolonged survival compared to the wild type strain. To study the expression of gelE, the regions flanking gelE were sequenced. Sequence analysis of the gelE flanking regions revealed three genes (fsrA, fsrB and fsrC) upstream of gelE that show homology to the genes in a locus (agr) that globally regulates the expression of virulence factors in Staphylococcus aureus and one open reading frame (sprE) with homology to bacterial serine protease downstream of gelE. ^ In conclusion, in this study of identification of possible virulence factors in E. faecalis surface and secreted proteins, of three genes encoding antigens detected by human patient sera, none could be shown to effect virulence in the mouse peritonitis model. Inactivation of one of these antigens (autolysin) was shown to slightly increase the tolerance of E. faecalis to penicillin. A serine protease and a locus (fsr) that regulates the expression of gelE and sprE were shown to be important for enterococcal infection in the mouse peritonitis model. (Abstract shortened by UMI.)^

A mechanism of insulin-like growth factor binding protein 2-induced cell mobility in glioma

Insulin-like growth factor binding protein 2 (IGFBP2) is a protein known to be overexpressed in a majority of glioblastoma multiforme (GBM) tumors. While it is known the IGFBP2 is involved in promoting GBM tumor cell invasion, no mechanism exists for how the protein is involved in signal transduction pathways leading to enhanced cell invasion. ^ We follow up on preliminary microarray data on IGFBP2-overexpressing GBM cells and protein sequence analysis of IGFBP2 in generating the hypothesis that IGFBP2 interacts with integnn α5 in regulating cell mobility. Microarray data showing upregulation of integrin α5 by IGFBP2 is validated and evidence of protein-protein interaction between IGFBP2 and integrin α5 is found. The exact binding domain on IGFBP2 responsible for its interaction with integrin α5 is also determined, confirming our initial findings and reaffirming that the IGFBP2/integrin α5 interaction is specific. Disruption of this interaction resulted in attenuation of IGFBP2-enhanced cell mobility. Further, we found that cell mobility is only enhanced when IGFBP2 and integrin α5 are both overexpressed and able to interact with each other. ^ We also determined fibronectin to be a critical player in the activation of the IGFBP2/integrin α5 pathway. The activation of this pathway appears to be progressive and initiates once GBM cells have sufficiently established anchorage. ^

MOLECULAR AND GENOMIC BASED INSIGHTS INTO THE EVOLUTION OF ENTEROCOCCUS FAECIUM FROM COMMENSAL TO HOSPITAL-ADAPTED PATHOGEN

The basis for the recent transition of Enterococcus faecium from a primarily commensal organism to one of the leading causes of hospital-acquired infections in the United States is not yet understood. To address this, the first part of my project assessed isolates from early outbreaks in the USA and South America using sequence analysis, colony hybridizations, and minimal inhibitory concentrations (MICs) which showed clinical isolates possess virulence and antibiotic resistance determinants that are less abundant or lacking in community isolates. I also revealed that the level of ampicillin resistance increased over time in clinical strains. By sequencing the pbp5 gene, I demonstrated an ~5% difference in the pbp5 gene between strains with MICs <4ug/ml and those with MICs >4µg/ml, but no specific sequence changes correlated with increases in MICs within the latter group. A 3-10% nucleotide difference was also seen in three other genes analyzed, which suggested the existence of two distinct subpopulations of E. faecium. This led to the second part of my project analyzing concatenated core gene sequences, SNPs, the 16S rRNA, and phylogenetics of 21 E. faecium genomes confirming two distinct clades; a community-associated (CA) clade and hospital-associated (HA) clade. Molecular clock calculations indicate that these two clades likely diverged ~ 300,000 to > 1 million years ago, long before the modern antibiotic era. Genomic analysis also showed that, in addition to core genomic differences, HA E. faecium harbor specific accessory genetic elements that may confer selection advantages over CA E. faecium. The third part of my project discovered 6 E. faecium genes with the newly identified “WxL” domain. My analyses, using RT-PCR, western blots, patient sera, whole-cell ELISA, and immunogold electron microscopy, indicated that E. faecium WxL genes exist in operons, encode bacterial cell surface localized proteins, that WxL proteins are antigenic in humans, and are more exposed on the surface of clinical isolates versus community isolates (even though they are ubiquitous in both clades). ELISAs and BIAcore analyses also showed that proteins encoded by these operons bind several different host extracellular matrix proteins, as well as to each other, suggesting a novel cell-surface complex. In summary, my studies provide new insights into the evolution of E. faecium by showing that there are two distantly related clades; one being more successful in the hospital setting. My studies also identified operons encoding WxL proteins whose characteristics could also contribute to colonization and virulence within this species.

Structure and biosynthesis of a pyruvate -dependent enzyme---phosphatidylserine decarboxylase from {\it Escherichia coli\/}

Phosphatidylserine decarboxylase of E. coli, a cytoplasmic membrane protein, catalyzes the formation of phosphatidylethanolamine, the principal phospholipid of the organism. The activity of the enzyme is dependent on a covalently bound pyruvate (Satre and Kennedy (1978) J. Biol. Chem. 253, 479-483). This study shows that the enzyme consists of two nonidentical subunits, $\alpha$ (Mr = 7,332) and $\beta$ (Mr = 28,579), with the pyruvate prosthetic group in amide linkage to the amino-terminus of the $\alpha$ subunit. Partial protein sequence and DNA sequence analysis reveal that the two subunits are derived from a proenzyme ($\pi$ subunit, Mr = 35,893) through a post-translational event. During the conversion of the proenzyme to the $\alpha$ and $\beta$ subunits, the peptide bond between Gly253-Ser254 is cleaved, and Ser254 is converted to the pyruvate prosthetic group at the amino-terminus of the $\alpha$ subunit (Li and Dowhan (1988) J. Biol. Chem. 263, 11516-11522).^ The proenzyme cannot be detected in cells carrying either single or multiple copies of the gene (psd), but can be observed in a T7 RNA polymerase/promoter and transcription-translation system. The cleavage of the wild-type proenzyme occurs rapidly with a half-time on the order of 2 min. Changing of the Ser254 to cysteine (S254C) or threonine (S254T) slows the cleavage rate dramatically and results in mutants with a half-time for processing of around 2-4 h. Change of the Ser254 to alanine (S254A) blocks the cleavage of the proenzyme. The reduced processing rate with the mutations of the proenzyme is consistent with less of the functional enzyme being made. Mutants S254C and S254T produce $\sim$15% and $\sim$1%, respectively, of the activity of the wild-type allele, but can still complement a temperature-sensitive mutant of the psd locus. Neither detectable activity nor complementation is observed by mutant S254A. These results are consistent with the hydroxyl-group of the Ser254 playing a critical role in the cleavage of the peptide bond Gly253-Ser254 of the pro-phosphatidylserine decarboxylase, and support the mechanism proposed by Snell and co-workers (Recsei and Snell (1984) Annu. Rev. Biochem. 53, 357-387) for the formation of the prosthetic group of pyruvate-dependent decarboxylases. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^