987 resultados para MOUSE


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A fundamental task in developmental biology is to understand the molecular mechanisms governing early embryogenesis. The aim of this study was to understand the developmental role of a putative basic helix-loop-helix (b-HLH) transcription factor, twist, during mouse embryogenesis.^ twist was originally identified in Drosophila as one of the zygotic genes, including snail, that were required for dorsal-ventral patterning. In Drosophila embryogenesis, twist is expressed in the cells of the ventral midline destined to form mesoderm. In embryos lacking twist expression, their ventral cells fail to form a ventral furrow and subsequently no mesoderm is formed.^ During mouse embryogenesis, twist is expressed after initial mesoderm formation in both mesoderm and cranial neural crest cell derivatives. To study the role of twist in vivo, twist-null embryos were generated by gene targeting. Embryos homozygous for the twist mutation die at midgestation. The most prominent phenotype in the present study was a failure of the cranial neural tube to close (exencephaly). twist-null embryos also showed defects in head mesenchyme, branchial arches, somites, and limb buds.^ To understand whether twist functions cell-autonomously and to investigate how twist-null cells interact with wild-type cells in vivo, twist chimeras composed of both twist-null and wild-type cells marked by the expression of the lacZgene were generated. Chimeric analysis revealed a correlation between the incidence of exencephaly and the contribution of the underlying twist-null head mesenchyme, thus strongly suggesting that twist-expressing head mesenchyme is required for the closure of the cranial neural tube. These studies have identified twist as a critical regulator for the mesenchymal fate determination within the cranial neural crest lineage. Most strikingly, twist-null head mesenchyme cells were always segregated from wild-type cells, indicating that the twist mutation altered the adhesive specificity of these cells. Furthermore, these results also indicated that twist functions cell-autonomously in the head, arch, and limb mesenchyme but non-cell-autonomously in the somites. Taken together, these studies have established the essential role of twist during mouse embryogenesis. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single-locus mutations in mice can express epileptic phenotypes and provide critical insights into the naturally occurring defects that alter excitability and mediate synchronization in the central nervous system (CNS). One such recessive mutation (on chromosome (Chr) 15), stargazer(stg/stg) expresses frequent bilateral 6-7 cycles per second (c/sec) spike-wave seizures associated with behavioral arrest, and provides a valuable opportunity to examine the inherited lesion associated with spike-wave synchronization.^ The existence of distinct and heterogeneous defects mediating spike-wave discharge (SWD) generation has been demonstrated by the presence of multiple genetic loci expressing generalized spike-wave activity and the differential effects of pharmacological agents on SWDs in different spike-wave epilepsy models. Attempts at understanding the different basic mechanisms underlying spike-wave synchronization have focused on $\gamma$-aminobutyric acid (GABA) receptor-, low threshold T-type Ca$\sp{2+}$ channel-, and N-methyl-D-aspartate receptor (NMDA-R)-mediated transmission. It is believed that defects in these modes of transmission can mediate the conversion of normal oscillations in a trisynaptic circuit, which includes the neocortex, reticular nucleus and thalamus, into spike-wave activity. However, the underlying lesions involved in spike-wave synchronization have not been clearly identified.^ The purpose of this research project was to locate and characterize a distinct neuronal hyperexcitability defect favoring spike-wave synchronization in the stargazer brain. One experimental approach for anatomically locating areas of synchronization and hyperexcitability involved an attempt to map patterns of hypersynchronous activity with antibodies to activity-induced proteins.^ A second approach to characterizing the neuronal defect involved examining the neuronal responses in the mutant following application of pharmacological agents with well known sites of action.^ In order to test the hypothesis that an NMDA receptor mediated hyperexcitability defect exists in stargazer neocortex, extracellular field recordings were used to examine the effects of CPP and MK-801 on coronal neocortical brain slices of stargazer and wild type perfused with 0 Mg$\sp{2+}$ artificial cerebral spinal fluid (aCSF).^ To study how NMDA receptor antagonists might promote increased excitability in stargazer neocortex, two basic hypotheses were tested: (1) NMDA receptor antagonists directly activate deep layer principal pyramidal cells in the neocortex of stargazer, presumably by opening NMDA receptor channels altered by the stg mutation; and (2) NMDA receptor antagonists disinhibit the neocortical network by blocking recurrent excitatory synaptic inputs onto inhibitory interneurons in the deep layers of stargazer neocortex.^ In order to test whether CPP might disinhibit the 0 Mg$\sp{2+}$ bursting network in the mutant by acting on inhibitory interneurons, the inhibitory inputs were pharmacologically removed by application of GABA receptor antagonists to the cortical network, and the effects of CPP under 0 Mg$\sp{2+}$aCSF perfusion in layer V of stg/stg were then compared with those found in +/+ neocortex using in vitro extracellular field recordings. (Abstract shortened by UMI.) ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Missense mutations in the p53 tumor-suppressor gene are the most common alterations of p53 in somatic tumors and in patients with Li-Fraumeni syndrome. p53 missense mutations occur in the DNA binding region and disrupt the ability of p53 to activate transcription. In vitro studies have shown that some p53 missense mutants have a gain-of-function or dominant-negative activity. ^ The p53 175 Arg-to-His (p53 R175H) mutation in humans has been shown to have dominant-negative and gain-of-function properties in vitro. This mutation is observed in the germline of individuals with Li-Fraumeni syndrome. To accurately model Li-Fraumeni syndrome and to examine the mechanistic nature of a gain-of-function missense mutation on in vivo tumorigenesis, we generated and characterized a mouse with the corresponding mutation, p53 R172H. p53R172H homozygous and heterozygous mice developed similar tumor spectra and survival curves as p53 −/− and p53+/− mice, respectively. However, tumors in p53+/R172H mice metastasized to various organs with high frequency, suggesting a gain-of-function phenotype by p53R172H in vivo. Mouse embryonic fibroblasts (MEFs) from p53R172H mice also showed gain-of-function phenotypes in cell proliferation, DNA synthesis, and transformation potential, while cells from p53+/− and p53−/− mice did not. ^ To mechanistically characterize the gain-of-function phenotype of the p53R172H mutant, the role of p53 family members, p63 and p73, was analyzed. Disruption of p63 and p73 by siRNAs in p53 −/− MEFs increased transformation potential and reinitiated DNA synthesis to levels observed in p53R172H/R172H cells. Additionally, p63 and p73 were bound and functionally inactivated by p53R172H in metastatic p53 R172H tumor-derived cell lines, indicating a role for the p53 family members in the gain-of-function phenotype. This study provides in vivo evidence for the gain-of-function effect of p53 missense mutations and more accurately models the Li-Fraumeni syndrome. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mutations in the TP53 gene are very common in human cancers, and are associated with poor clinical outcome. Transgenic mouse models lacking the Trp53 gene or that express mutant Trp53 transgenes produce tumours with malignant features in many organs. We previously showed the transcriptome of a p53-deficient mouse skin carcinoma model to be similar to those of human cancers with TP53 mutations and associated with poor clinical outcomes. This report shows that much of the 682-gene signature of this murine skin carcinoma transcriptome is also present in breast and lung cancer mouse models in which p53 is inhibited. Further, we report validated gene-expression-based tests for predicting the clinical outcome of human breast and lung adenocarcinoma. It was found that human patients with cancer could be stratified based on the similarity of their transcriptome with the mouse skin carcinoma 682-gene signature. The results also provide new targets for the treatment of p53-defective tumours.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Función mitocondrial en ratas

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Estrogen is known to increase progesterone receptor (PR) levels in the wild-type mouse uterus, and this estrogen induction was thought to be important for progesterone action through the PR. The estrogen receptor α knockout (ERKO) mouse uterus was observed to express PR mRNA that cannot be induced by estrogen. Progesterone action was characterized to determine whether it was diminished in ERKO mice. The PR protein is present in the ERKO uterus at 60% of the level measured in a wild-type uterus. The PR-A and PR-B isoforms are both detected on Western blot, and the ratio of isoforms is the same in both genotypes. Although the level of PR is reduced in the ERKO uterus, the receptor level is sufficient to induce genomic responses, since both calcitonin and amphiregulin mRNAs were increased after progesterone treatment. Finally, the ERKO uterus can be induced to undergo a progesterone-dependent decidual response. Surprisingly, the decidual response is estrogen independent in the ERKO, although it remains estrogen dependent in a wild type. These results indicate that estrogen receptor α modulation of PR levels is not necessary for expression of the PR or genomic and physiologic responses to progesterone in the ERKO uterus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Imprinted genes tend to occur in clusters. We have identified a cluster in distal mouse chromosome (Chr) 2, known from early genetic studies to contain both maternally and paternally imprinted, but unspecified, genes. Subsequently, one was identified as Gnas, which encodes a G protein α subunit, and there is clinical and biochemical evidence that the human homologue GNAS1, mutated in patients with Albright hereditary osteodystrophy, is also imprinted. We have used representational difference analysis, based on parent-of-origin methylation differences, to isolate candidate imprinted genes in distal Chr 2 and found two oppositely imprinted genes, Gnasxl and Nesp. Gnasxl determines a variant G protein α subunit associated with the trans-Golgi network and Nesp encodes a secreted protein of neuroendocrine tissues. Gnasxl is maternally methylated in genomic DNA and encodes a paternal-specific transcript, whereas Nesp is paternally methylated with maternal-specific expression. Their reciprocal imprinting may offer insight into the distal Chr 2 imprinting phenotypes. Remarkably, Gnasxl, Nesp, and Gnas are all part of the same transcription unit; transcripts for Gnasxl and Nesp are alternatively spliced onto exon 2 of Gnas. This demonstrates an imprinting mechanism in which two oppositely imprinted genes share the same downstream exons.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dosage compensation in mammals occurs by X inactivation, a silencing mechanism regulated in cis by the X inactivation center (Xic). In response to developmental cues, the Xic orchestrates events of X inactivation, including chromosome counting and choice, initiation, spread, and establishment of silencing. It remains unclear what elements make up the Xic. We previously showed that the Xic is contained within a 450-kb sequence that includes Xist, an RNA-encoding gene required for X inactivation. To characterize the Xic further, we performed deletional analysis across the 450-kb region by yeast-artificial-chromosome fragmentation and phage P1 cloning. We tested Xic deletions for cis inactivation potential by using a transgene (Tg)-based approach and found that an 80-kb subregion also enacted somatic X inactivation on autosomes. Xist RNA coated the autosome but skipped the Xic Tg, raising the possibility that X chromosome domains escape inactivation by excluding Xist RNA binding. The autosomes became late-replicating and hypoacetylated on histone H4. A deletion of the Xist 5′ sequence resulted in the loss of somatic X inactivation without abolishing Xist expression in undifferentiated cells. Thus, Xist expression in undifferentiated cells can be separated genetically from somatic silencing. Analysis of multiple Xic constructs and insertion sites indicated that long-range Xic effects can be generalized to different autosomes, thereby supporting the feasibility of a Tg-based approach for studying X inactivation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ligand-controlled retinoic acid (RA) receptors and retinoid X receptors are important for several physiological processes, including normal embryonic development, but little is known about how their ligands, all-trans and 9-cis RA, are generated. Here we report the identification of a stereo-specific 9-cis retinol dehydrogenase, which is abundantly expressed in embryonic tissues known to be targets in the retinoid signaling pathway. The membrane-bound enzyme is a member of the short-chain alcohol dehydrogenase/reductase superfamily, able to oxidize 9-cis retinol into 9-cis retinaldehyde, an intermediate in 9-cis RA biosynthesis. Analysis by nonradioactive in situ hybridization in mouse embryos shows that expression of the enzyme is temporally and spatially well controlled during embryogenesis with prominent expression in parts of the developing central nervous system, sensory organs, somites and myotomes, and several tissues of endodermal origin. The identification of this enzyme reveals a pathway in RA biosynthesis, where 9-cis retinol is generated for subsequent oxidation to 9-cis RA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have identified the mutation responsible for the autosomal recessive wasted (wst) mutation of the mouse. Wasted mice are characterized by wasting and neurological and immunological abnormalities starting at 21 days after birth; they die by 28 days. A deletion of 15.8 kb in wasted mice abolishes expression of a gene called Eef1a2, encoding a protein that is 92% identical at the amino acid level to the translation elongation factor EF1α (locus Eef1a). We have found no evidence for the involvement of another gene in this deletion. Expression of Eef1a2 is reciprocal with that of Eef1a. Expression of Eef1a2 takes over from Eef1a in heart and muscle at precisely the time at which the wasted phenotype becomes manifest. These data suggest that there are tissue-specific forms of the translation elongation apparatus essential for postnatal survival in the mouse.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The genetic pathways that control development of the early mammalian embryo have remained poorly understood, in part because the systematic mutant screens that have been so successful in the identification of genes and pathways that direct embryonic development in Drosophila, Caenorhabditis elegans, and zebrafish have not been applied to mammalian embryogenesis. Here we demonstrate that chemical mutagenesis with ethylnitrosourea can be combined with the resources of mouse genomics to identify new genes that are essential for mammalian embryogenesis. A pilot screen for abnormal morphological phenotypes of midgestation embryos identified five mutant lines; the phenotypes of four of the lines are caused by recessive traits that map to single regions of the genome. Three mutant lines display defects in neural tube closure: one is caused by an allele of the open brain (opb) locus, one defines a previously unknown locus, and one has a complex genetic basis. Two mutations produce novel early phenotypes and map to regions of the genome not previously implicated in embryonic patterning.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apolipoprotein E- (apoE) deficient (E−/−) mice develop severe hyperlipidemia and diffuse atherosclerosis. Low-dose expression of a human apoE3 transgene in macrophages of apoE-deficient mice (E−/−hTgE+/0), which results in about 5% of wild-type apoE plasma levels, did not correct hyperlipidemia but significantly reduced the extent of atherosclerotic lesions. To investigate the contribution of apoE to reverse cholesterol transport, we compared plasmas of wild-type (E+/+), E−/−, and E−/−hTgE+/0 mice for the appearance of apoE-containing lipoproteins by electrophoresis and their capacity to take up and esterify 3H-labeled cholesterol from radiolabeled fibroblasts or J774 macrophages. Wild-type plasma displayed lipoproteins containing apoE that were the size of high density lipoprotein and that had either electrophoretic α or γ mobilities. Similar particles were also present in E−/−hTgE+/0 plasma. Depending on incubation time, E−/− plasma released 48–74% less 3H-labeled cholesterol from fibroblasts than E+/+ plasma, whereas cholesterol efflux into E−/−hTgE+/0 plasma was only 11–25% lower than into E+/+ plasma. E−/−hTgE+/0 plasma also released 10% more 3H-labeled cholesterol from radiolabeled J774 macrophages than E−/− plasma. E+/+ and E−/−hTgE+/0 plasma each esterified significantly more cell-derived 3H-labeled cholesterol than E−/− plasma. Moreover, E−/− plasma accumulated much smaller proportions of fibroblast-derived 3H-labeled cholesterol in fractions with electrophoretic γ and α mobility than E+/+ and E−/−hTgE+/0 plasma. Thus, low-dose expression of apoE in macrophages nearly restored the cholesterol efflux capacity of apoE-deficient plasma through the formation of apoE-containing particles, which efficiently take up cell-derived cholesterol, and through the increase of cholesterol esterification activity. Thus, macrophage-derived apoE may protect against atherosclerosis by increasing cholesterol efflux from arterial wall cells.