Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Low Modulus Hot Pour Joint Sealant for ACC Pavements, HR-534, 1990

Over the years, the Iowa Department of Transportation has established an outstanding network of connector highways across the state of Iowa. Construction and paving of these primary roadways has essentially been completed. Unfortunately, many of these primary highway pavements are reaching their design life and are in need of rehabilitation. The emphasis, therefore, has shifted from the construction of new highways to the maintenance and rehabilitation of existing highways. The Iowa DOT in recent years has become more concerned with preventing the ingress of surface water into the pavement structure. Crack sealing is receiving greater emphasis. Specifications have been modified to require improved low modulus crack and joint sealing materials.

The Effects of Crushed Particles in Asphalt Mixtures, HR-311 and MLR-88-16, 1990

One of the most serious impediments to the continued successful use of hot-mix asphalt (HMA) pavements is rutting. The Iowa Department of Transportation has required 85% crushed particles and 75-blow Marshall mix design in an effort to prevent rutting on Interstate roadways. Relationships between the percent of crushed particles and resistance to rutting in pavement through the use of various laboratory test procedures must be developed. HMA mixtures were made with 0, 30, 60, 85, and 100% crushed gravel, crushed limestone, and crushed quartzite combined with uncrushed sand and gravel. These aggregate combinations were used with 4, 5, and 6% asphalt cement (ac). Laboratory tests included Marshall stability, resilient modulus, indirect tensile, and creep. A creep resistance factor (CRF) was developed to provide a single numeric value for creep test results. The CRF values relate well to the amount of crushed particles and the perceived resistance to rutting. The indirect tensile test is highly dependent on the ac with a small effect from the percent of crushed particles. The Marshall stability from 75-blow compaction relates well to the percent of crushed particles. The resilient modulus in some cases is highly affected by grade of ac.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Retrofit Methods for Distortion Cracking Problems in Plate Girder Bridges, TR-436, 2003

This report is formatted to independently present four individual investigations related to similar web gap fatigue problems. Multiple steel girder bridges commonly exhibit fatigue cracking due to out-of-plane displacement of the web near the diaphragm connections. This fatigue-prone web gap area is typically located in negative moment regions of the girders where the diaphragm stiffener is not attached to the top flange. In the past, the Iowa Department of Transportation has attempted to stop fatigue crack propagation in these steel girder bridges by drilling holes at the crack tips. Other nondestructive retrofits have been tried; in a particular case on a two-girder bridge with floor beams, angles were bolted between the stiffener and top flange. The bolted angle retrofit has failed in the past and may not be a viable solution for diaphragm bridges. The drilled hole retrofit is often only a temporary solution, so a more permanent and effective retrofit is required. A new field retrofit has been developed that involves loosening the bolts in the connection between the diaphragm and the girders. Research on the retrofit has been initiated; however, no long-term studies of the effects of bolt loosening have been performed. The intent of this research is to study the short-term effects of the bolt loosening retrofit on I-beam and channel diaphragm bridges. The research also addressed the development of a continuous remote monitoring system to investigate the bolt loosening retrofit on an X-type diaphragm bridge over a number of months, ensuring that the measured strain and displacement reductions are not affected by time and continuous traffic loading on the bridge. The testing for the first three investigations is based on instrumentation of web gaps in a negative moment region on Iowa Department of Transportation bridges with I-beam, channel, and X-type diaphragms. One bridge of each type was instrumented with strain gages and deflection transducers. Field tests, using loaded trucks of known weight and configuration, were conducted on the bridges with the bolts in the tight condition and after implementing the bolt loosening retrofit to measure the effects of loosening the diaphragm bolts. Long-term data were also collected on the X-diaphragm bridge by a data acquisition system that collected the data continuously under ambient truck loading. The collected data were retrievable by an off-site modem connection to the remote data acquisition system. The data collection features and ruggedness of this system for remote bridge monitoring make it viable as a pilot system for future monitoring projects in Iowa. Results indicate that loosening the diaphragm bolts reduces strain and out-of-plane displacement in the web gap, and that the reduction is not affected over time by traffic or environmental loading on the bridge. Reducing the strain in the web gap allows the bridge to support more cycles of loading before experiencing fatigue, thus increase the service life of the bridge. Two-girder floor beam bridges may also exhibit fatigue cracking in girder webs.

Determination of Asphalt Content and Characteristics of Bituminous Paving Mixtures, MLR-88-11, 1988

Due to the hazardous nature of chemical asphalt extraction agents, nuclear gauges have become an increasingly popular method of determining the asphalt content of a bituminous mix. This report details the results of comparisons made between intended, tank stick, extracted, and nuclear asphalt content determinations. A total of 315 sets of comparisons were made on samples that represented 110 individual mix designs and 99 paving projects. All samples were taken from 1987 construction projects. In addition to the comparisons made, seventeen asphalt cement samples were recovered for determination of penetration and viscosity. Results were compared to similar tests performed on the asphalt assurance samples in an attempt to determine the amount of asphalt hardening that can be expected due to the hot mix process. Conclusions of the report are: 1. Compared to the reflux extraction procedure, nuclear asphalt content gauges determine asphalt content of bituminous mixes with much greater accuracy and comparable precision. 2. As a means for determining asphalt content, the nuclear procedure should be used as an alternate to chemical extractions whenever possible. 3. Based on penetration and viscosity results, softer grade asphalts undergo a greater degree 'of hardening due to hot mix processing than do harder grades, and asphalt viscosity changes caused by the mixing process are subject to much more variability than are changes in penetration. 4. Based on changes in penetration and viscosity, the Thin Film Oven Test provides a reasonable means of estimating how much asphalt hardening can be anticipated due to exposure to the hot mix processing environment.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.