Development of a Conductometric Test for Frost Resistance of Concrete, HR-272, 1988

Research is described that was aimed at developing a test method which can be reasonably and rapidly performed in the laboratory and in the field to predict, with a high degree of certainty, the behavior of concrete subjected to the action of alternate freezing and thawing. The conductometric evaluation of concrete durability was explored with 3 different test methods: conductometric evaluation of the resistance of concrete to rapid freezing and thawing; conductomtric evaluation of the resistance of concrete to natural freezing and thawing, and conductometric evaluation of the pore size distribution of concrete and its correlation to concrete durability. The study showed that conductance could be used as a viable method for determining the durability of portland cement concrete. This would also allow the continuous monitoring of concrete durability without the removal twice per week from the freeze/thaw chamber. Recommendations for the continued development of these test methods are also included.

Test result-based sampling: an efficient design for estimating the accuracy of patient safety indicators.

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Figures des histoires de la Sainte Bible , avec des discours qui contiennent exactement ce qui est écrit de plus remarquable dans l'ancien et le nouveau Testament... Nouvelle édition, revüe & corrigée...

[Bible (français). 1724]

Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Precast Concrete Panel Thickness for Epoxy-Coated Prestressing Strands, Volume 1, HR-353, 1994

This final report for Phase 1 of the research on epoxy-coated, prestressing strands in precast prestressed concrete (PC) panels has been published in two volumes. This volume, Volume 1--Technical Report, contains the problem description, literature review, and survey results; descriptions of the test specimens, experimental tests, and analytical models; discussions of the analytical and experimental results; summary, conclusions, and recommendations; list of references; and acknowledgment. Volume 2--Supplemental Report contains additional information in the form of summarized responses to the questionnaires; graphs showing the strand forces; figures showing the geometry of the specimens and concrete crack patterns that formed in the strand transfer length and strand development length specimens; and graphs of the concrete strains in the strand transfer length specimens, load-point deflections, and strand-slip measurements for the strand development length specimens.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Deicing Salt Corrosion with and without Inhibitors, MLR-87-8, 1989

Chloride ion penetration through concrete to reinforcing steel is causing the premature deterioration of numerous bridge decks in Iowa. The purpose of the research reported in this paper was to determine whether any of several additives or alternative deicing chemicals could inhibit corrosion of reinforcing steel. The deicers tested were calcium magnesium acetate (CMA), CMA plus NaCl (NaCl: sodium chloride), Quicksalt plus PCI, and CG-90, a polyphosphate solution being developed by Cargill. Two tests were established. First, steel coupons were placed in a 15% solution of a deicer and distilled water to determine which alternative deicer would cause the least amount of corrosion in solution. The coupons were weighed periodically to determine each coupon's weight loss from corrosion. The second test involved ponding a 15% solution of each material on reinforced concrete blocks. Weekly copper-copper sulfate electrical half-cell (CSE) potential readings were taken on each block to determine whether corrosive activity was occurring at the steel surface. When the ponding research was concluded, concrete samples were taken from one of the three blocks ponded with each deicer. The samples were used to determine the chloride ion content at the level of the steel. Results show that all the deicers were less corrosive than NaCl. Only pure CMA, however, significantly inhibited the corrosion of steel embedded in concrete.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Validation of real-time methylation-specific PCR to determine O6-methylguanine-DNA methyltransferase gene promoter methylation in glioma.

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.