998 resultados para CT-DNA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To determine subregions of normal and abnormal cartilage in advanced stages of femorotibial osteoarthritis (OA) by mapping the entire femorotibial joint in a cohort of pre-total knee replacement (TKR) OA knees. DESIGN: We defined an areal subdivision of the femorotibial articular cartilage surface on CT arthrography (CTA), allowing the division of the femorotibial articular surface into multiple (up to n = 204 per knee) subregions and the comparison of the same areas between different knees. Two readers independently classified each cartilage area as normal, abnormal or non-assessable in 41 consecutive pre-TKR OA knees. RESULTS: A total of 6447 cartilage areas (from 41 knees) were considered assessable by both readers. The average proportion of preserved cartilage was lower in the medial femorotibial joint than in the lateral femorotibial joint for both readers (32.0/69.8% and 33.9/68.5% (medial/lateral) for reader 1 and 2 respectively, all P < 0.001). High frequencies of normal cartilage were observed at the posterior aspect of the medial condyle (up to 89%), and the anterior aspect of the lateral femorotibial compartment (up to 100%). The posterior aspect of the medial condyle was the area that most frequently exhibited preserved cartilage in the medial femorotibial joint, contrasting with the high frequency of cartilage lesions in the rest of that compartment. CONCLUSIONS: Cartilage at the posterior aspect of the medial condyle, and at the anterior aspect of the lateral femorotibial compartment, may be frequently preserved in advanced grades of OA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Glioblastoma multiforme (GBM; World Health Organization astrocytoma grade IV) is the most frequent and most malignant primary brain tumor in adults. Despite multimodal therapy, all such tumors practically recur during the course of therapy, causing a median survival of only 14.6 months in patients with newly diagnosed GBM. The present study was aimed at examining the expression of the DNA repair protein AlkB homolog 2 (ALKBH2) in human GBM and determining whether it could promote resistance to temozolomide chemotherapy. METHODS: ALKBH2 expression in GBM cell lines and in human GBM was determined by quantitative real-time PCR (qRT-PCR) and gene expression analysis, respectively. Drug sensitivity was assessed in GBM cells overexpressing ALKBH2 and in cells in which ALKBH2 expression was silenced by small-interfering (si)RNA. ALKBH2 expression following activation of the p53 pathway was examined by western blotting and qRT-PCR. RESULTS: ALKBH2 was abundantly expressed in established GBM cell lines and human GBM, and temozolomide exposure increased cellular ALKBH2 expression levels. Overexpression of ALKBH2 in the U87 and U251 GBM cell lines enhanced resistance to the methylating agents temozolomide and methyl methanesulfonate but not to the nonmethylating agent doxorubicin. Conversely, siRNA-mediated knockdown of ALKBH2 increased sensitivity of GBM cells to temozolomide and methyl methanesulfonate but not to doxorubicin or cisplatin. Nongenotoxic activation of the p53 pathway by the selective murine double minute 2 antagonist nutlin-3 caused a significant decrease in cellular ALKBH2 transcription levels. CONCLUSION: Our findings identify ALKBH2 as a novel mediator of temozolomide resistance in human GBM cells. Furthermore, we place ALKBH2 into a new cellular context by showing its regulation by the p53 pathway.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aim: Pleural effusion is common in cancer patients and to determine its malignant origin is of huge clinical significance. PET/CT with 18F-FDG is of diagnostic value in staging and follow-up, but its ability to differentiate between malignant and benign effusions is not precisely known. Patients, methods: We examined 50 PET/CT from 47 patients (29 men, 18 women, 60±16 years) with pleural effusion and known cancer (24 NSCLC, 7 lymphomas, 5 breasts, 4 GIST, 3 mesotheliomas, 2 head and neck, 2 malignant teratoma, 1 colorectal, 1 oesophageal, 1 melanoma) for FDG uptake in the effusions using SUVmax. This was correlated to cytopathology performed after a median of 21 days (interquartile range -3 to 23), which included pH, relative distribution (macrophages, neutrophils, eosinophils, basophils, lymphocytes, plasmocytes), and absolute cell count. Results: Malignant cells were found in 17 effusions (34%) (6 NSCLC, 5 lymphomas, 2 breasts, 2 mesotheliomas, 2 malignant teratomas). SUV in malignant effusions were higher than in benign ones [3.7 (95%CI 1.8-5.6) vs. 1.7 g/ml (1.5-1.9), p = 0.001], with a correlation between malignant effusion and SUV (Spearman coefficient r = 0.50, p = 0.001), but not with other cytopathological or radiological parameters (ROC area 0.83±0.06). Using a 2.2-mg/l SUV threshold, 12 PET/CT studies were positive and 38 negative with sensitivity, specificity, positive and negative predictive values of 53%, 91%, 75% and 79%, respectively. For NSCLC only (n = 24), ROC area was 0.95±0.04, 7 studies were positive and 17 negative with a sensitivity, specificity, positive and negative predictive values of 83%, 89%, 71 and 94%, respectively. Conclusion: PET/CT may help to differentiate the malignant or benign origin of a pleural effusion with a high specificity in patients with known cancer, in particular NSCLC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The estrogen-responsive element (ERE) present in the 5'-flanking region of the Xenopus laevis vitellogenin (vit) gene B1 has been characterized by transient expression analysis of chimeric vit-tk-CAT (chloramphenicol acetyltransferase) gene constructs transfected into the human estrogen-responsive MCF-7 cell line. The vit B1 ERE behaves like an inducible enhancer, since it is able to confer estrogen inducibility to the heterologous HSV thymidine kinase (tk) promoter in a relative position- and orientation-independent manner. In this assay, the minimal B1 ERE is 33 bp long and consists of two 13 bp imperfect palindromic elements both of which are required for the enhancer activity. A third imperfect palindromic element is present further upstream within the 5'-flanking region of the gene but is unable to confer hormone responsiveness by itself. Similarly, neither element forming the B1 ERE can alone confer estrogen inducibility to the tk promoter. However, in combinations of two, all three imperfect palindromes can act cooperatively to form a functional ERE. In contrast a single 13 bp perfect palindromic element, GGTCACTGTGACC, such as the one found upstream of the vit gene A2, is itself sufficient to act as a fully active ERE. Single point mutations within this element abolish estrogen inducibility, while a defined combination of two mutations converts this ERE into a glucocorticoid-responsive element.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Following wider acceptance of 'the thrifty phenotype' hypothesis and the convincing evidence that early-life exposures can influence adult health even decades after the exposure, much interest has been placed on the mechanisms through which early-life exposures become biologically embedded. MATERIALS AND METHODS: In this review, we summarize the current literature regarding biological embedding of early-life experiences. To this end, we conducted a literature search to identify studies investigating early-life exposures in relation to DNA methylation changes. In addition, we summarize the challenges faced in investigations of epigenetic effects, stemming from the peculiarities of this emergent and complex field. A proper systematic review and meta-analyses were not feasible given the nature of the evidence. RESULTS: We identified seven studies on early-life socio-economic circumstances, 10 studies on childhood obesity and six studies on early-life nutrition all relating to DNA methylation changes that met the stipulated inclusion criteria. The pool of evidence gathered, albeit small, favours a role of epigenetics and DNA methylation in biological embedding, but replication of findings, multiple comparison corrections, publication bias and causality are concerns remaining to be addressed in future investigations. CONCLUSIONS: Based on these results, we hypothesize that epigenetics, in particular DNA methylation, is a plausible mechanism through which early-life exposures are biologically embedded. This review describes the current status of the field and acts as a stepping stone for future, better designed investigations on how early-life exposures might become biologically embedded through epigenetic effects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Currently, there is no reliable method to differentiate acute from chronic carotid occlusion. We propose a novel CTA-based method to differentiate acute from chronic carotid occlusions that could potentially aid clinical management of patients. METHODS: We examined 72 patients with 89 spontaneously occluded extracranial internal carotids with CT angiography (CTA). All occlusions were confirmed by another imaging modality and classified as acute (imaging <1 week of presumed occlusion) orchronic (imaging >4 weeks), based on circumstantial clinical and radiological evidence. A neuroradiologist and a neurologist blinded to clinical information determined the site of occlusion on axial sections of CTA. They also looked for (a) hypodensity in the carotid artery (thrombus), (b) contrast within the carotid wall (vasa vasorum), (c) the site of the occluded carotid, and (d) the "carotid ring sign" (defined as presence of a and/or b). RESULTS: Of 89 occluded carotids, 24 were excluded because of insufficient circumstantial evidence to determine timing of occlusion, 4 because of insufficient image quality, and 3 because of subacute timing of occlusion. Among the remaining 45 acute and 13 chronic occlusions, inter-rater agreement (kappa) for the site of proximal occlusion was 0.88, 0.45 for distal occlusion, 0.78 for luminal hypodensity, 0.82 for wall contrast, and 0.90 for carotid ring sign. The carotid ring sign had 88.9% sensitivity, 69.2% specificity, and 84.5% accuracy to diagnose acute occlusion. CONCLUSION: The carotid ring sign helps to differentiate acute from chronic carotid occlusion. If further confirmed, this information may be helpful in studying ischemic symptoms and selecting treatment strategies in patients with carotid occlusions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Osteochondritis dissecans (OCD) is a joint disorder that affects the articular cartilage and subchondral bone, most commonly at the knee. OCD of the sacroiliac joint is extremely rare. Management of OCD remains controversial, and surgery is often needed, especially when conservative treatment fails. We present a rare case of OCD involving the left sacroiliac joint successfully treated by percutaneous computed tomography-guided retrograde drilling and debridement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: Although several approaches have been already used to reduce radiation dose, CT doses are still among the high doses in radio-diagnostic. Recently, General Electric introduced a new imaging reconstruction technique, adaptive statistical iterative reconstruction (ASIR), allows to taking into account the statistical fluctuation of noise. The benefits of ASIR method were assessed through classic metrics and the evaluations of cardiac structures by radiologists. Methods and materials: A 64-row CT (MDCT) was employed. Catphan600 phantom acquisitions and 10 routine-dose CT examinations performed at 80 kVp were reconstructed with FBP and with 50% of ASIR. Six radiologists then assessed the visibility of main cardiac structures using the visual grading analysis (VGA) method. Results: On phantoms, for a constant value of SD (25 HU), CTDIvol is divided by 2 (8 mGy to 4 mGy) when 50% of ASIR is used. At constant CTDIvol, MTF medium frequencies were also significantly improved. First results indicated that clinical images reconstructed with ASIR had a better overall image quality compared with conventional reconstruction. This means that at constant image quality the radiation dose can be strongly reduced. Conclusion: The first results of this study shown that the ASIR method improves the image quality on phantoms by decreasing noise and improving resolution with respect to the classical one. Moreover, the benefit obtained is higher at lower doses. In clinical environment, a dose reduction can still be expected on 80 kVp low dose pediatric protocols using 50% of iterative reconstruction. Best ASIR percentage as a function of cardiac structures and detailed protocols will be presented for cardiac examinations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: (18)F-Fluorocholine (FCH) and (11)C-acetate (ACE) PET are widely used for detection of recurrent prostate cancer (PC). We present the first results of a comparative, prospective PET/CT study of both tracers evaluated in the same patients presenting with recurrence and low PSA to compare the diagnostic information provided by the two tracers. METHODS: The study group comprised 23 patients studied for a rising PSA level after radical prostatectomy (RP, 7 patients, PSA ≤ 3 ng/ml), curative radiotherapy (RT, 7 patients, PSA ≤ 5 ng/ml) or RP and salvage RT (9 patients, PSA ≤ 5 ng/ml). Both FCH and ACE PET/CT scans were performed in a random sequence a median of 4 days (range 0 to 11 days) apart. FCH PET/CT was started at injection (307 ± 16 MBq) with a 10-min dynamic acquisition of the prostate bed, followed by a whole-body PET scan and late (45 min) imaging of the pelvis. ACE PET/CT was performed as a double whole-body PET scan starting 5 and 22 min after injection (994 ± 72 MBq), and a late view (45 min) of the prostate bed. PET/CT scans were blindly reviewed by two independent pairs of two experienced nuclear medicine physicians, discordant subgroup results being discussed to reach a consensus for positive, negative end equivocal results. RESULTS: PET results were concordant in 88 out of 92 local, regional and distant findings (Cohen's kappa 0.929). In particular, results were concordant in all patients concerning local status, bone metastases and distant findings. Lymph-node results were concordant in 19 patients and different in 4 patients. On a per-patient basis results were concordant in 22 of 23 patients (14 positive, 5 negative and 3 equivocal). In only one patient was ACE PET/CT positive for nodal metastases while FCH PET/CT was overall negative; interestingly, the ACE-positive and FCH-negative lymph nodes became positive in a second FCH PET/CT scan performed a few months later. CONCLUSION: Overall, ACE and FCH PET/CT showed excellent concordance, on both a per-lesion and a per-patient basis, suggesting that both tracers perform equally for recurrent prostate cancer staging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: Cervical foraminal injection performed with a direct approach of the foramen may induce serious neurologic complications. Cervical facet joint (CFJ) injections are easier to perform and safe, and may diffuse in the epidural and foraminal spaces. We analyzed the efficiency and tolerance of CT-guided CFJ slow-acting corticosteroid injection in patients with radiculopathy related to disc herniation. Methods and materials: Pilot study included 17 patients presenting typical cervical radiculopathy related to disc herniation without relief of pain after medical treatment (one month duration). CFJ puncture was performed under CT guidance with a lateral approach. CT control of the CFJ opacification was performed after injections of contrast agent (1 ml), followed by slow-acting corticosteroid (25 mg). Main criteria for judgment was pain relief one month later (delta visual analogical scale VAS for 0 to 100 mm). Diffusion of iodinated contrast agent in the foramen was assessed by two radiologists in consensus. Results: Pain relief was significant at one month (delta VAS 22 ± 23 mm, p = 0.001) and 41% (7/17) of patients had pain relief more than 50%. In cases with foraminal diffusion, pain relief more than 50% occured in 5 patients (50%) and only in 2 patients (29%) in cases without foraminal diffusion. No complication occurred. Conclusion: CT-guided CFJ slow-acting corticosteroid injection is safe and provided good results at one month follow-up. It may be considered as an interesting percutaneous treatment in patients suffering from cervical radicular pain related to disc herniation.