979 resultados para saturated NaCl solution


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The suitability of the caco-2 cell line as a model for studying the long term impact of dietary fatty acids on intestinal lipid handling and chylomicron production was examined. Chronic supplementation of caco-2 cells with palmitic acid (PA) resulted in a lower triacylglycerol secretion than oleic acid (OA). This was coupled with a detrimental effect of PA, but not OA, on transepithelial electrical resistance (TER) measurements, suggesting a loss of structural integrity across the cell monolayer. Addition of OA reversed the adverse effects of PA and stearic acid on TER and increased the ability of cells to synthesise and accumulate lipid, but did not normalise the secretion of lipids by caco-2 cells. Increasing amounts of OA and decreasing amounts of PA in the incubation media markedly improved the ability of cells to synthesise apolipoprotein B and secrete lipids. Real time RT-PCR revealed a down regulation of genes involved in lipoprotein synthesis following PA than OA. Electron microscopy showed adverse effects of PA on cellular morphology consistent with immature enterocytes such as stunted microvilli and poor tight junction formation. In conclusion, previously reported differences in lipoprotein secretion by caco-2 cells supplemented with saturated fatty acids (SFA) and OA may partly reflect early cytotoxic effects of SFA on cellular integrity and function. (C) 2007 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Annatto dyes are widely used in food and are finding increasing interest also for their application in the pharmaceutical and cosmetics industry. Bixin is the main pigment extracted from annatto seeds and accounts for 80% of the carotenoids in the outer coat of the seeds; norbixin being the water-soluble form of the bixin. Typically annatto dyes are extracted from the seeds by mechanical means or solutions of alkali, edible oil or organic solvents, or a combination of the two depending on the desired final product. In this work CGAs are investigated as an alternative separation method for the recovery of norbixin from a raw extraction solution of annatto pigments in KOH. A volume of CGAs generated from a cationic surfactant (CTAB) solution is mixed with a volume of annatto solution and when the mixture is allowed to settle it separates into the top aphron phase and the bottom liquid phase. Potassium norbixinate presented in the annatto solution will interact with the surfactant in the aphron phase, which results in the effective separation of norbixin. Recovery= 94% was achieved at a CTAB to norbixin molar ratio of 3.3. In addition a mechanism of separation is proposed here based on the separation results with the cationic surfactant and an anionic surfactant (bis-2-ethyl hexyl sulfosuccinate, AOT) and measurements of surfactant to norbixin ratio in the aphron phase; electrostatic interactions between the surfactant and norbixin molecules result in the fort-nation of a coloured complex and effective separation of norbixin. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper is turned to the advanced Monte Carlo methods for realistic image creation. It offers a new stratified approach for solving the rendering equation. We consider the numerical solution of the rendering equation by separation of integration domain. The hemispherical integration domain is symmetrically separated into 16 parts. First 9 sub-domains are equal size of orthogonal spherical triangles. They are symmetric each to other and grouped with a common vertex around the normal vector to the surface. The hemispherical integration domain is completed with more 8 sub-domains of equal size spherical quadrangles, also symmetric each to other. All sub-domains have fixed vertices and computable parameters. The bijections of unit square into an orthogonal spherical triangle and into a spherical quadrangle are derived and used to generate sampling points. Then, the symmetric sampling scheme is applied to generate the sampling points distributed over the hemispherical integration domain. The necessary transformations are made and the stratified Monte Carlo estimator is presented. The rate of convergence is obtained and one can see that the algorithm is of super-convergent type.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Most research on distributed space time block coding (STBC) has so far focused on the case of 2 relay nodes and assumed that the relay nodes are perfectly synchronised at the symbol level. By applying STBC to 3-or 4-relay node systems, this paper shows that imperfect synchronisation causes significant performance degradation to the conventional detector. To this end, we propose a new STBC detection solution based on the principle of parallel interference cancellation (PIC). The PIC detector is moderate in computational complexity but is very effective in suppressing the impact of imperfect synchronisation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock-reflection test problem in the case of slab, cylindrical, or spherical symmetry is discussed. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankie-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We use a spectral method to solve numerically two nonlocal, nonlinear, dispersive, integrable wave equations, the Benjamin-Ono and the Intermediate Long Wave equations. The proposed numerical method is able to capture well the dynamics of the solutions; we use it to investigate the behaviour of solitary wave solutions of the equations with special attention to those, among the properties usually connected with integrability, for which there is at present no analytic proof. Thus we study in particular the resolution property of arbitrary initial profiles into sequences of solitary waves for both equations and clean interaction of Benjamin-Ono solitary waves. We also verify numerically that the behaviour of the solution of the Intermediate Long Wave equation as the model parameter tends to the infinite depth limit is the one predicted by the theory.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We study the effects of NaCl on the self-assembly of AAKLVFF and beta A beta AKLVFF in solution. Both AAKLVFF and beta A beta AKLVFF self-assemble into twisted fibers in aqueous solution. The addition of NaCl to aqueous solutions of AAKLVFF produces large crystal-like nanotapes which eventually precipitate. In contrast, highly twisted fibrils were observed for beta A beta AKLVFF solutions at low salt concentration, while a coexistence of highly twisted fibers and nanotubes was observed for beta A beta AKLVFF at high salt concentration. The self-assembled structures observed for beta A beta AKLVFF in NaCl solutions were ascribed to the progressive screening of the beta A beta AKLVFF surface charge caused by the addition of salt.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Overseas trained teachers (OTTs) have grown in numbers during the past decade, particularly in London and the South East of England. In this recruitment explosion many OTTs have experienced difficulties. In professional literature as well as press coverage OTTs often become part of a deficit discourse. A small-scale pilot investigation of OTT experience has begun to suggest why OTTs have been successful as well as the principal challenges they have faced. An important factor in their success was felt to be the quality of support in school from others on the staff. Major challenges included the complexity of the primary curriculum. The argument that globalisation leads to brain-drain may be exaggerated. Suggestions for further research are made, which might indicate the positive benefits OTTs can bring to a school.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nonstructural protein 3 of the severe acute respiratory syndrome (SARS) coronavirus includes a "SARS-unique domain" (SUD) consisting of three globular domains separated by short linker peptide segments. This work reports NMR structure determinations of the C-terminal domain (SUD-C) and a two-domain construct (SUD-MC) containing the middle domain (SUD-M) and the C-terminal domain, and NMR data on the conformational states of the N-terminal domain (SUD-N) and the SUD-NM two-domain construct. Both SUD-N and SUD-NM are monomeric and globular in solution; in SUD-NM, there is high mobility in the two-residue interdomain linking sequence, with no preferred relative orientation of the two domains. SUD-C adopts a frataxin like fold and has structural similarity to DNA-binding domains of DNA-modifying enzymes. The structures of both SUD-M (previously determined) and SUD-C (from the present study) are maintained in SUD-MC, where the two domains are flexibly linked. Gel-shift experiments showed that both SUD-C and SUD-MC bind to single-stranded RNA and recognize purine bases more strongly than pyrimidine bases, whereby SUD-MC binds to a more restricted set of purine-containing RNA sequences than SUD-M. NMR chemical shift perturbation experiments with observations of (15)N-labeled proteins further resulted in delineation of RNA binding sites (i.e., in SUD-M, a positively charged surface area with a pronounced cavity, and in SUD-C, several residues of an anti-parallel beta-sheet). Overall, the present data provide evidence for molecular mechanisms involving the concerted actions of SUD-M and SUD-C, which result in specific RNA binding that might be unique to the SUD and, thus, to the SARS coronavirus.